Transcript: Human NM_001164213.2

Homo sapiens leucine rich repeats and calponin homology domain containing 1 (LRCH1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
LRCH1 (23143)
Length:
4709
CDS:
228..2318

Additional Resources:

NCBI RefSeq record:
NM_001164213.2
NBCI Gene record:
LRCH1 (23143)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164213.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434412 GGCAAACTGAGGGCATAATAA pLKO_005 1525 CDS 100% 15.000 12.000 N LRCH1 n/a
2 TRCN0000418220 ACCTGAACTTGAGTCGAAATC pLKO_005 667 CDS 100% 10.800 7.560 N LRCH1 n/a
3 TRCN0000129514 GCACCAACTCAGGAGAAGAAA pLKO.1 1396 CDS 100% 5.625 3.938 N LRCH1 n/a
4 TRCN0000128103 CAGTTTACAATCCGGAGGAAA pLKO.1 1923 CDS 100% 4.950 3.465 N LRCH1 n/a
5 TRCN0000130851 GCCAGTATTCTCCAAATGAGA pLKO.1 1789 CDS 100% 3.000 2.100 N LRCH1 n/a
6 TRCN0000129380 GCAGTTTACAATCCGGAGGAA pLKO.1 1922 CDS 100% 2.640 1.848 N LRCH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164213.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07841 pDONR223 100% 89.5% 87.6% None (many diffs) n/a
2 ccsbBroad304_07841 pLX_304 0% 89.5% 87.6% V5 (many diffs) n/a
3 TRCN0000466610 GGATCTTAATCTCCTCTTCAGGCG pLX_317 15.6% 89.5% 87.6% V5 (many diffs) n/a
Download CSV