Transcript: Human XM_006715349.4

PREDICTED: Homo sapiens solute carrier family 2 member 12 (SLC2A12), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC2A12 (154091)
Length:
4345
CDS:
172..1788

Additional Resources:

NCBI RefSeq record:
XM_006715349.4
NBCI Gene record:
SLC2A12 (154091)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006715349.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000042899 CGGCATTCTTTCTGCCTATAT pLKO.1 702 CDS 100% 13.200 18.480 N SLC2A12 n/a
2 TRCN0000042900 CCTTGCTAAATGCTGGATTAA pLKO.1 1478 CDS 100% 13.200 9.240 N SLC2A12 n/a
3 TRCN0000042901 CCCGAATAATGATAGGACTAA pLKO.1 1001 CDS 100% 4.950 3.465 N SLC2A12 n/a
4 TRCN0000042902 CCCTGAGAAATGATGTGGATA pLKO.1 1433 CDS 100% 4.950 3.465 N SLC2A12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006715349.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09707 pDONR223 100% 81.9% 77.5% None (many diffs) n/a
2 ccsbBroad304_09707 pLX_304 0% 81.9% 77.5% V5 (many diffs) n/a
3 TRCN0000473948 CCAGACTGTGGGTCATGGTATCGC pLX_317 18.7% 81.9% 77.5% V5 (many diffs) n/a
Download CSV