Transcript: Human NR_110524.2

Homo sapiens nuclear receptor subfamily 1 group D member 2 (NR1D2), transcript variant 3, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
NR1D2 (9975)
Length:
5338
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_110524.2
NBCI Gene record:
NR1D2 (9975)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_110524.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365703 ATGGTACGGTTCGCATCATTA pLKO_005 1739 3UTR 100% 13.200 18.480 N NR1D2 n/a
2 TRCN0000365706 GAATGGTGATCTCGCCAATAT pLKO_005 461 3UTR 100% 13.200 18.480 N NR1D2 n/a
3 TRCN0000376665 TCGTGCACTAAGGACCTTAAT pLKO_005 1999 3UTR 100% 13.200 18.480 N NR1D2 n/a
4 TRCN0000022193 CGCCAATATTGAAGGCATCTT pLKO.1 473 3UTR 100% 4.950 6.930 N NR1D2 n/a
5 TRCN0000022192 GCCCTCCAACTTAGTGATGAA pLKO.1 1883 3UTR 100% 4.950 6.930 N NR1D2 n/a
6 TRCN0000022189 CGCATCATTATTTGATGCAAA pLKO.1 1750 3UTR 100% 0.495 0.693 N NR1D2 n/a
7 TRCN0000365778 ATTACTACCACAAGACTATTT pLKO_005 2543 3UTR 100% 13.200 9.240 N NR1D2 n/a
8 TRCN0000365705 TTGCCAGATCTTCGATCTTTA pLKO_005 2072 3UTR 100% 13.200 9.240 N NR1D2 n/a
9 TRCN0000022190 CCAATGAGTAAGTCTCCATAT pLKO.1 1553 3UTR 100% 10.800 7.560 N NR1D2 n/a
10 TRCN0000370922 GTGGAATTTGCAAAGCGTATT pLKO_005 1649 3UTR 100% 10.800 7.560 N NR1D2 n/a
11 TRCN0000022191 CCAGTACAAGAAGTGCCTGAA pLKO.1 698 3UTR 100% 4.050 2.835 N NR1D2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_110524.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488448 GACGTTCAGTGGAATCGCTATCCC pLX_317 18.2% 32.5% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489584 CTCCCCAAGTGTGCGCTCTTCCGA pLX_317 18% 32.4% V5 (many diffs) n/a
3 ccsbBroadEn_11440 pDONR223 100% 22.9% None 1_293del;1518_5338del n/a
4 ccsbBroad304_11440 pLX_304 0% 22.9% V5 1_293del;1518_5338del n/a
5 TRCN0000474337 CAAGAGCTACGATCTACTCCCCCA pLX_317 29.6% 22.9% V5 1_293del;1518_5338del n/a
Download CSV