Transcript: Human NM_001355230.1

Homo sapiens major facilitator superfamily domain containing 14C (MFSD14C), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-12-22
Taxon:
Homo sapiens (human)
Gene:
MFSD14C (84278)
Length:
1901
CDS:
317..751

Additional Resources:

NCBI RefSeq record:
NM_001355230.1
NBCI Gene record:
MFSD14C (84278)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001355230.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155509 CCTCGGCACTGTATTCTTTAC pLKO.1 655 CDS 100% 10.800 5.400 Y MFSD14C n/a
2 TRCN0000151902 CAACACACATTCCTCATGAAT pLKO.1 542 CDS 100% 5.625 2.813 Y MFSD14C n/a
3 TRCN0000154350 CAATCCCACTGATGAGGATCA pLKO.1 684 CDS 100% 4.050 2.025 Y MFSD14C n/a
4 TRCN0000152086 CACTGTATTCTTTACCTGCTT pLKO.1 661 CDS 100% 2.640 1.320 Y MFSD14C n/a
5 TRCN0000153160 GCACTGTATTCTTTACCTGCT pLKO.1 660 CDS 100% 2.160 1.080 Y MFSD14C n/a
6 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 1272 3UTR 100% 1.080 0.540 Y GPR83 n/a
7 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 1272 3UTR 100% 1.080 0.540 Y MYORG n/a
8 TRCN0000151493 CTCATGAATGGTCTCATTCAA pLKO.1 554 CDS 100% 0.563 0.281 Y MFSD14C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001355230.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10264 pDONR223 100% 47.1% 45.3% None (many diffs) n/a
2 ccsbBroad304_10264 pLX_304 0% 47.1% 45.3% V5 (many diffs) n/a
3 TRCN0000470777 GTACTCACCACGTTGCAGTTCAGG pLX_317 100% 47.1% 45.3% V5 (many diffs) n/a
Download CSV