Transcript: Human NM_001368053.1

Homo sapiens RAD9 checkpoint clamp component B (RAD9B), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
RAD9B (144715)
Length:
3113
CDS:
222..1238

Additional Resources:

NCBI RefSeq record:
NM_001368053.1
NBCI Gene record:
RAD9B (144715)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001368053.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000157271 GCCTGAGTTTGGAGTGGAATA pLKO.1 1217 CDS 100% 10.800 7.560 N RAD9B n/a
2 TRCN0000150764 GAATGGACACTGAGATAACAT pLKO.1 667 CDS 100% 5.625 3.938 N RAD9B n/a
3 TRCN0000155318 GCTGTACACAGTGAGATGTTT pLKO.1 612 CDS 100% 5.625 3.938 N RAD9B n/a
4 TRCN0000156129 CTTGCTGTTACTCCACTGAAT pLKO.1 546 CDS 100% 4.950 3.465 N RAD9B n/a
5 TRCN0000154732 GAGATGTTTGTTGGCTCAGAT pLKO.1 624 CDS 100% 4.950 3.465 N RAD9B n/a
6 TRCN0000154622 GCCACATTAGCTGATGAACAA pLKO.1 825 CDS 100% 4.950 3.465 N RAD9B n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2001 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001368053.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13227 pDONR223 100% 66.9% 63.3% None (many diffs) n/a
2 ccsbBroad304_13227 pLX_304 0% 66.9% 63.3% V5 (many diffs) n/a
3 TRCN0000476165 AGCAGACAAGTCACAGTGCGCCGT pLX_317 38.8% 66.9% 63.3% V5 (many diffs) n/a
4 ccsbBroadEn_13226 pDONR223 100% 62.6% 61.2% None 1_258del;908_909ins109;963_1014del n/a
5 ccsbBroad304_13226 pLX_304 0% 62.6% 61.2% V5 1_258del;908_909ins109;963_1014del n/a
Download CSV