Transcript: Human NM_174937.4

Homo sapiens transcription elongation regulator 1 like (TCERG1L), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
TCERG1L (256536)
Length:
2618
CDS:
87..1847

Additional Resources:

NCBI RefSeq record:
NM_174937.4
NBCI Gene record:
TCERG1L (256536)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_174937.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428357 GTGATACGTCGATCCCTTAAT pLKO_005 2060 3UTR 100% 13.200 18.480 N TCERG1L n/a
2 TRCN0000015479 CCTCGTTTGCTGGCAAATCAA pLKO.1 657 CDS 100% 5.625 7.875 N TCERG1L n/a
3 TRCN0000412881 ACGGGAGCCTCTGTAACAATC pLKO_005 2153 3UTR 100% 10.800 7.560 N TCERG1L n/a
4 TRCN0000015481 GAGGCAAAGAGAGAGGACAAA pLKO.1 1377 CDS 100% 4.950 3.465 N TCERG1L n/a
5 TRCN0000015478 GCTCAACTCTGAGGAACGAAA pLKO.1 1547 CDS 100% 4.950 3.465 N TCERG1L n/a
6 TRCN0000015480 TGGGAGAAAGAATTACACAAA pLKO.1 1500 CDS 100% 4.950 3.465 N TCERG1L n/a
7 TRCN0000015482 CGTCTCAGATACAAGGACAGA pLKO.1 935 CDS 100% 2.640 1.848 N TCERG1L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_174937.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14455 pDONR223 100% 92.7% 92.3% None (many diffs) n/a
2 ccsbBroad304_14455 pLX_304 0% 92.7% 92.3% V5 (many diffs) n/a
3 TRCN0000481163 GCATAGAAGATCACATGCCTCTCG pLX_317 25.5% 92.7% 92.3% V5 (many diffs) n/a
Download CSV