Transcript: Human XM_017010172.2

PREDICTED: Homo sapiens high mobility group nucleosomal binding domain 4 (HMGN4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HMGN4 (10473)
Length:
2088
CDS:
362..634

Additional Resources:

NCBI RefSeq record:
XM_017010172.2
NBCI Gene record:
HMGN4 (10473)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017010172.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000115688 TCAGCTCGGTTGTCTGCTAAA pLKO.1 434 CDS 100% 10.800 15.120 N HMGN4 n/a
2 TRCN0000289635 TCAGCTCGGTTGTCTGCTAAA pLKO_005 434 CDS 100% 10.800 15.120 N HMGN4 n/a
3 TRCN0000233401 TGGTTGTCTCTGCACTATTTA pLKO_005 1565 3UTR 100% 15.000 10.500 N HMGN4 n/a
4 TRCN0000233400 TGCCAAGTGAAATGTACATTT pLKO_005 625 CDS 100% 13.200 9.240 N HMGN4 n/a
5 TRCN0000115687 CCTCCATATTACTTCTAGAAT pLKO.1 1876 3UTR 100% 5.625 3.938 N HMGN4 n/a
6 TRCN0000234488 GATGAGCCACAGAGGAGATCA pLKO_005 416 CDS 100% 4.950 3.465 N HMGN4 n/a
7 TRCN0000233398 GGATGGGAACAACCCTGCAAA pLKO_005 553 CDS 100% 4.950 3.465 N HMGN4 n/a
8 TRCN0000115691 TCTACACTCCAGTCCCAGAAA pLKO.1 587 CDS 100% 4.950 3.465 N HMGN4 n/a
9 TRCN0000233399 TCTACACTCCAGTCCCAGAAA pLKO_005 587 CDS 100% 4.950 3.465 N HMGN4 n/a
10 TRCN0000115689 CTCTGCAAAGAAGGGAGAGAA pLKO.1 493 CDS 100% 4.950 2.970 N HMGN4 n/a
11 TRCN0000115690 GATAAAGCAAAGGTGAAGGAT pLKO.1 398 CDS 100% 3.000 1.500 Y HMGN4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017010172.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07617 pDONR223 100% 99.6% 100% None 198G>A n/a
2 ccsbBroad304_07617 pLX_304 0% 99.6% 100% V5 198G>A n/a
3 TRCN0000478291 GACTAATCTACCGGTGAGCGGTTG pLX_317 100% 99.6% 100% V5 198G>A n/a
4 ccsbBroadEn_00754 pDONR223 100% 86.2% 86.6% None (many diffs) n/a
5 ccsbBroad304_00754 pLX_304 0% 86.2% 86.6% V5 (many diffs) n/a
6 TRCN0000465397 CGTGTAGCACCTTCTGGCTCTCTA pLX_317 100% 86.2% 86.6% V5 (many diffs) n/a
Download CSV