Transcript: Human XR_002958879.1

PREDICTED: Homo sapiens leucine rich repeat containing 37 member A4, pseudogene (LRRC37A4P), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LRRC37A4P (55073)
Length:
7293
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958879.1
NBCI Gene record:
LRRC37A4P (55073)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958879.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265548 AGGTGAGGATCAAGCTTATTA pLKO_005 1877 3UTR 100% 15.000 7.500 Y LRRC37A2 n/a
2 TRCN0000254452 TCAATCTCCGGAACCTATTAA pLKO_005 2462 3UTR 100% 15.000 7.500 Y LRRC37A2 n/a
3 TRCN0000254451 AGACTTAACCCACGCTATTTC pLKO_005 4841 3UTR 100% 13.200 6.600 Y LRRC37A2 n/a
4 TRCN0000254450 TCACCATCAAACTCATCATTT pLKO_005 2216 3UTR 100% 13.200 6.600 Y LRRC37A2 n/a
5 TRCN0000121902 CCAGCGTTACAGTTCAACTTT pLKO.1 2833 3UTR 100% 5.625 2.813 Y LRRC37A n/a
6 TRCN0000143055 CCCAAGAAGCTGAAGAAAGAT pLKO.1 1461 3UTR 100% 5.625 2.813 Y LRRC37A n/a
7 TRCN0000167461 GATGTGAAATCACTGTTACTA pLKO.1 4419 3UTR 100% 5.625 2.813 Y LRRC37A2 n/a
8 TRCN0000141309 CCAGGTCACCATCAAACTCAT pLKO.1 2211 3UTR 100% 4.950 2.475 Y LRRC37A n/a
9 TRCN0000180259 CCTCCTATGGAGCATGAACTT pLKO.1 2067 3UTR 100% 4.950 2.475 Y LRRC37A3 n/a
10 TRCN0000144003 CCTTGCTGAGATTATTGGAAT pLKO.1 1499 3UTR 100% 4.950 2.475 Y LRRC37A n/a
11 TRCN0000145536 CGAAGGTCATTACAAGAAGAT pLKO.1 5844 3UTR 100% 4.950 2.475 Y LRRC37A n/a
12 TRCN0000142354 GCAGATGTGGAGGTTACCATA pLKO.1 1926 3UTR 100% 4.950 2.475 Y LRRC37A n/a
13 TRCN0000180805 GCGGAGATGAGATGTTGTCAT pLKO.1 3529 3UTR 100% 4.950 2.475 Y LRRC37A3 n/a
14 TRCN0000142010 GCTGGACCTTTAGCAGTTCAA pLKO.1 2427 3UTR 100% 4.950 2.475 Y LRRC37A n/a
15 TRCN0000144231 CATCCAAGATAGAATGGGATA pLKO.1 5629 3UTR 100% 4.050 2.025 Y LRRC37A n/a
16 TRCN0000180204 CCATCATTCCAGAACCCACTA pLKO.1 3283 3UTR 100% 4.050 2.025 Y LRRC37A3 n/a
17 TRCN0000143717 GAAAGACTTAACCCACGCTAT pLKO.1 4838 3UTR 100% 4.050 2.025 Y LRRC37A n/a
18 TRCN0000180361 GCCACAGTTCAACCTTTGGAT pLKO.1 2646 3UTR 100% 3.000 1.500 Y LRRC37A3 n/a
19 TRCN0000116227 CCTCCCAAAGTTCTGGGATTA pLKO.1 30 3UTR 100% 1.080 0.540 Y ELOVL7 n/a
20 TRCN0000164591 CCTCCCAAAGTTCTGGGATTA pLKO.1 30 3UTR 100% 1.080 0.540 Y TNNI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958879.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13034 pDONR223 100% 30% None (many diffs) n/a
2 ccsbBroad304_13034 pLX_304 0% 30% V5 (many diffs) n/a
3 TRCN0000466676 ACGATCGTGATATACAATGGCACG pLX_317 15.7% 30% V5 (many diffs) n/a
4 ccsbBroadEn_13730 pDONR223 100% 2.5% None (many diffs) n/a
5 ccsbBroad304_13730 pLX_304 0% 2.5% V5 (many diffs) n/a
6 TRCN0000476265 TCACAAGTTGTGGGCATTGCGCAC pLX_317 100% 2.5% V5 (many diffs) n/a
Download CSV