Transcript: Human NM_001047.4

Homo sapiens steroid 5 alpha-reductase 1 (SRD5A1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
SRD5A1 (6715)
Length:
7035
CDS:
138..917

Additional Resources:

NCBI RefSeq record:
NM_001047.4
NBCI Gene record:
SRD5A1 (6715)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001047.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230329 GGGTAATAACTGCTGATATTT pLKO_005 1146 3UTR 100% 15.000 9.000 N SRD5A1 n/a
2 TRCN0000230326 CTACGGGCATCGGTGCTTAAT pLKO_005 419 CDS 100% 13.200 7.920 N SRD5A1 n/a
3 TRCN0000230328 CTGTACCTGTAACGGCTATTT pLKO_005 506 CDS 100% 13.200 7.920 N SRD5A1 n/a
4 TRCN0000230327 GCGTGTACAATGGCGATTATG pLKO_005 483 CDS 100% 13.200 7.920 N SRD5A1 n/a
5 TRCN0000026585 CCAGGAGATACTGGATACAAA pLKO.1 669 CDS 100% 5.625 3.375 N SRD5A1 n/a
6 TRCN0000026562 CGGCTATTTGCAAAGCAGATA pLKO.1 518 CDS 100% 4.950 2.970 N SRD5A1 n/a
7 TRCN0000026546 GAGGCTTATTTGAATACGTAA pLKO.1 700 CDS 100% 4.950 2.970 N SRD5A1 n/a
8 TRCN0000218975 CCATTCAGATCATATCCTAAG pLKO_005 635 CDS 100% 6.000 3.000 Y SRD5A1 n/a
9 TRCN0000026523 CCTCCGGAAATTTGAAGAGTA pLKO.1 857 CDS 100% 4.950 2.475 Y SRD5A1 n/a
10 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 5144 3UTR 100% 4.950 2.475 Y LOC387873 n/a
11 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 5108 3UTR 100% 4.950 2.475 Y n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001047.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06993 pDONR223 100% 99.8% 100% None 90C>G n/a
2 ccsbBroad304_06993 pLX_304 0% 99.8% 100% V5 90C>G n/a
3 TRCN0000473518 TCCTACTTATTAACTTCATAGTAA pLX_317 54% 99.8% 100% V5 90C>G n/a
4 TRCN0000488266 GAAGAGTGTCCTCTGGCGGATACA pLX_317 34.4% 99.8% 100% V5 (not translated due to prior stop codon) 90C>G n/a
5 TRCN0000491270 GCCGGGCCCCTCGCAAGAATAGTA pLX_317 30.6% 99.7% 99.6% V5 90C>G;777_778insG n/a
Download CSV