Transcript: Human XR_001751888.2

PREDICTED: Homo sapiens potassium channel tetramerization domain containing 13 (KCTD13), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCTD13 (253980)
Length:
1257
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001751888.2
NBCI Gene record:
KCTD13 (253980)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001751888.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044099 CTTTGGTACAATCCTCAATTA pLKO.1 469 3UTR 100% 13.200 18.480 N KCTD13 n/a
2 TRCN0000044098 CCCGAACAGCAAATACGTGAA pLKO.1 304 3UTR 100% 4.050 5.670 N KCTD13 n/a
3 TRCN0000300277 CCCGAACAGCAAATACGTGAA pLKO_005 304 3UTR 100% 4.050 5.670 N KCTD13 n/a
4 TRCN0000044100 CAACCGCAGTAACAACAAGTA pLKO.1 718 3UTR 100% 4.950 3.465 N KCTD13 n/a
5 TRCN0000300279 CAACCGCAGTAACAACAAGTA pLKO_005 718 3UTR 100% 4.950 3.465 N KCTD13 n/a
6 TRCN0000044101 CCATTGTCTATGCTACGGAGA pLKO.1 992 3UTR 100% 2.160 1.512 N KCTD13 n/a
7 TRCN0000300278 CCATTGTCTATGCTACGGAGA pLKO_005 992 3UTR 100% 2.160 1.512 N KCTD13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001751888.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05294 pDONR223 100% 78% None (many diffs) n/a
2 ccsbBroad304_05294 pLX_304 0% 78% V5 (many diffs) n/a
3 TRCN0000474705 AACACTTAGAATGTCGTCGGGTGC pLX_317 38.5% 78% V5 (many diffs) n/a
Download CSV