Transcript: Human NR_046429.2

Homo sapiens odontogenesis associated phosphoprotein (ODAPH), transcript variant 4, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ODAPH (152816)
Length:
1876
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_046429.2
NBCI Gene record:
ODAPH (152816)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_046429.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377729 CTACCGACTGCCAGATCTTTA pLKO_005 291 3UTR 100% 13.200 18.480 N ODAPH n/a
2 TRCN0000136597 CTGGTTACTGGTATGCTGGTT pLKO.1 44 3UTR 100% 2.640 2.112 N ODAPH n/a
3 TRCN0000134792 CTTTGTCAGCAGTGAAGATAT pLKO.1 580 3UTR 100% 13.200 9.240 N ODAPH n/a
4 TRCN0000135027 CATCACTGACTAGAAACTGTT pLKO.1 557 3UTR 100% 4.950 3.465 N ODAPH n/a
5 TRCN0000136211 GTTCTCTTTGTCAGCAGTGAA pLKO.1 575 3UTR 100% 4.950 3.465 N ODAPH n/a
6 TRCN0000137402 GAGGAAGCTCATCTGAGGAAA pLKO.1 405 3UTR 100% 4.950 2.970 N ODAPH n/a
7 TRCN0000116227 CCTCCCAAAGTTCTGGGATTA pLKO.1 174 3UTR 100% 1.080 0.540 Y ELOVL7 n/a
8 TRCN0000164591 CCTCCCAAAGTTCTGGGATTA pLKO.1 174 3UTR 100% 1.080 0.540 Y TNNI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_046429.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09691 pDONR223 100% 12.6% None (many diffs) n/a
2 ccsbBroad304_09691 pLX_304 0% 12.6% V5 (many diffs) n/a
3 TRCN0000475345 TGGGGTCACTTCCCAACTTTGGTA pLX_317 80.3% 12.6% V5 (many diffs) n/a
4 ccsbBroadEn_12783 pDONR223 100% 10% None (many diffs) n/a
5 ccsbBroad304_12783 pLX_304 0% 10% V5 (many diffs) n/a
6 TRCN0000478282 TATCTGCTCCACCGGGCTCCGTTG pLX_317 100% 10% V5 (many diffs) n/a
7 ccsbBroadEn_10261 pDONR223 100% 3.5% None (many diffs) n/a
8 ccsbBroad304_10261 pLX_304 0% 3.5% V5 (many diffs) n/a
9 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 3.5% V5 (many diffs) n/a
Download CSV