Transcript: Human XM_011519930.3

PREDICTED: Homo sapiens adaptor related protein complex 2 subunit alpha 2 (AP2A2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AP2A2 (161)
Length:
2237
CDS:
173..2173

Additional Resources:

NCBI RefSeq record:
XM_011519930.3
NBCI Gene record:
AP2A2 (161)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011519930.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000065127 CCGAGTCATTCAGATCGTCAT pLKO.1 1561 CDS 100% 4.050 5.670 N AP2A2 n/a
2 TRCN0000065123 CCAGGATTACACTTACTATTT pLKO.1 904 CDS 100% 13.200 10.560 N AP2A2 n/a
3 TRCN0000289836 CCAGGATTACACTTACTATTT pLKO_005 904 CDS 100% 13.200 10.560 N AP2A2 n/a
4 TRCN0000381985 GATCCGAATTGCTGGTGATTA pLKO_005 1519 CDS 100% 13.200 9.240 N AP2A2 n/a
5 TRCN0000380093 GCTCTTGATGGCTATAGTAAA pLKO_005 317 CDS 100% 13.200 9.240 N AP2A2 n/a
6 TRCN0000381976 GGCGGTCTTCATCTCGGATAT pLKO_005 211 CDS 100% 10.800 7.560 N AP2A2 n/a
7 TRCN0000065125 CGTCTGCAAGTTGCTCTTCAT pLKO.1 346 CDS 100% 4.950 3.465 N AP2A2 n/a
8 TRCN0000289834 CGTCTGCAAGTTGCTCTTCAT pLKO_005 346 CDS 100% 4.950 3.465 N AP2A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011519930.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14534 pDONR223 58.4% 54.9% 77.4% None (many diffs) n/a
2 ccsbBroad304_14534 pLX_304 0% 54.9% 77.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_05788 pDONR223 99.7% 69.7% 69.7% None (many diffs) n/a
4 ccsbBroad304_05788 pLX_304 0% 69.7% 69.7% V5 (many diffs) n/a
5 TRCN0000491951 GGGGGTACAACGGGGGCATTATCG pLX_317 3.8% 69.7% 69.7% V5 (many diffs) n/a
Download CSV