Transcript: Human XM_011545997.2

PREDICTED: Homo sapiens ring finger protein 40 (RNF40), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNF40 (9810)
Length:
3108
CDS:
118..3093

Additional Resources:

NCBI RefSeq record:
XM_011545997.2
NBCI Gene record:
RNF40 (9810)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011545997.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004783 CGCCACCTGATTAGTAGTCTT pLKO.1 1567 CDS 100% 4.950 6.930 N RNF40 n/a
2 TRCN0000318640 CGCCACCTGATTAGTAGTCTT pLKO_005 1567 CDS 100% 4.950 6.930 N RNF40 n/a
3 TRCN0000004781 CGCATCGAGTTTGAGCAGAAT pLKO.1 1504 CDS 100% 4.950 3.960 N RNF40 n/a
4 TRCN0000318639 CGCATCGAGTTTGAGCAGAAT pLKO_005 1504 CDS 100% 4.950 3.960 N RNF40 n/a
5 TRCN0000004782 GCAGCTTAACTCTGGCTACTA pLKO.1 1032 CDS 100% 4.950 3.465 N RNF40 n/a
6 TRCN0000004784 GCAGAAGTTTGAGATGCTGAA pLKO.1 1104 CDS 100% 4.050 2.430 N RNF40 n/a
7 TRCN0000318703 GCAGAAGTTTGAGATGCTGAA pLKO_005 1104 CDS 100% 4.050 2.430 N RNF40 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011545997.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02248 pDONR223 100% 95% 92.6% None (many diffs) n/a
2 ccsbBroad304_02248 pLX_304 0% 95% 92.6% V5 (many diffs) n/a
3 TRCN0000469337 CCATCATAGAGAAAGGCATTTGCG pLX_317 2.5% 95% 92.6% V5 (many diffs) n/a
Download CSV