Transcript: Human XR_429214.4

PREDICTED: Homo sapiens mitochondrial calcium uptake 2 (MICU2), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MICU2 (221154)
Length:
1796
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_429214.4
NBCI Gene record:
MICU2 (221154)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_429214.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055851 CACTCGAACATGAAGGAGAAT pLKO.1 326 3UTR 100% 4.950 6.930 N MICU2 n/a
2 TRCN0000055849 GCTAATTTCATATACCGAGTA pLKO.1 510 3UTR 100% 4.050 5.670 N MICU2 n/a
3 TRCN0000104684 CTGCAGAAGATCATAAGTAAA pLKO.1 640 3UTR 100% 13.200 9.240 N Micu2 n/a
4 TRCN0000294073 TACTTGCTTTCTGATTCATAA pLKO_005 1363 3UTR 100% 13.200 9.240 N MICU2 n/a
5 TRCN0000055850 GCTGCAGAAGATCATAAGTAA pLKO.1 639 3UTR 100% 5.625 3.938 N MICU2 n/a
6 TRCN0000286722 GCTGCAGAAGATCATAAGTAA pLKO_005 639 3UTR 100% 5.625 3.938 N MICU2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_429214.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16131 pDONR223 0% 62.6% None 1_42del;973_974ins109;1236_1796del n/a
2 ccsbBroad304_16131 pLX_304 0% 62.6% V5 1_42del;973_974ins109;1236_1796del n/a
3 TRCN0000480119 GGTCCACTGTTAAACGCCGCTGGG pLX_317 31.3% 62.5% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_09868 pDONR223 100% 62.4% None (many diffs) n/a
5 ccsbBroad304_09868 pLX_304 0% 62.4% V5 (many diffs) n/a
6 TRCN0000480665 CACCATTCAATAATCAGCAACCTC pLX_317 34.1% 62.4% V5 (many diffs) n/a
Download CSV