Transcript: Human XM_024448458.1

PREDICTED: Homo sapiens general transcription factor IIH subunit 1 (GTF2H1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GTF2H1 (2965)
Length:
2842
CDS:
35..1681

Additional Resources:

NCBI RefSeq record:
XM_024448458.1
NBCI Gene record:
GTF2H1 (2965)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448458.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000085942 GCCAATCGTTTAAATGTGAAT pLKO.1 464 CDS 100% 4.950 3.960 N Gtf2h1 n/a
2 TRCN0000288317 GCCAATCGTTTAAATGTGAAT pLKO_005 464 CDS 100% 4.950 3.960 N Gtf2h1 n/a
3 TRCN0000295596 ATGAGCTAAGTTGCAAATATA pLKO_005 1901 3UTR 100% 15.000 10.500 N Gtf2h1 n/a
4 TRCN0000315385 ATTCTGGGCCAATCGTTTAAA pLKO_005 457 CDS 100% 15.000 10.500 N GTF2H1 n/a
5 TRCN0000315380 GATATCATTGAGTCCATATTT pLKO_005 605 CDS 100% 15.000 10.500 N GTF2H1 n/a
6 TRCN0000315381 ATGACCTCACAGGAGTGATAA pLKO_005 1768 3UTR 100% 13.200 9.240 N GTF2H1 n/a
7 TRCN0000006065 GCTGCCATCATCAAGAGATTT pLKO.1 935 CDS 100% 13.200 9.240 N GTF2H1 n/a
8 TRCN0000315377 GCTGCCATCATCAAGAGATTT pLKO_005 935 CDS 100% 13.200 9.240 N GTF2H1 n/a
9 TRCN0000006066 CCAACTCCAATCCAGTCACTA pLKO.1 1190 CDS 100% 4.950 3.465 N GTF2H1 n/a
10 TRCN0000006067 CCTACAACAAGCTCCACACAT pLKO.1 1629 CDS 100% 4.950 3.465 N GTF2H1 n/a
11 TRCN0000315378 CCTACAACAAGCTCCACACAT pLKO_005 1629 CDS 100% 4.950 3.465 N GTF2H1 n/a
12 TRCN0000006064 CCTGAATAATAAAGAGGGAAT pLKO.1 2376 3UTR 100% 4.050 2.835 N GTF2H1 n/a
13 TRCN0000006068 GTCCATTGAATATGAAGACTT pLKO.1 1102 CDS 100% 4.950 2.970 N GTF2H1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448458.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14662 pDONR223 99.2% 98.5% 43.5% None (many diffs) n/a
2 ccsbBroad304_14662 pLX_304 0% 98.5% 43.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000469991 GAACACTGGTACGACCTCTTACCG pLX_317 22.2% 98.5% 43.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV