Transcript: Human NM_001346462.2

Homo sapiens centrosomal protein 83 (CEP83), transcript variant 8, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
CEP83 (51134)
Length:
2788
CDS:
526..1272

Additional Resources:

NCBI RefSeq record:
NM_001346462.2
NBCI Gene record:
CEP83 (51134)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346462.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242815 GCATAAAGCTGAACGAGAAAT pLKO_005 1107 CDS 100% 13.200 10.560 N CEP83 n/a
2 TRCN0000242817 AGGCTGAAGTAGCGGAATTAA pLKO_005 896 CDS 100% 15.000 10.500 N CEP83 n/a
3 TRCN0000167263 CATACATTTCTCAAGTCAGAA pLKO.1 676 CDS 100% 4.950 3.465 N CEP83 n/a
4 TRCN0000168559 GAGCTACAATCAAGCAGTGAA pLKO.1 1060 CDS 100% 4.950 3.465 N CEP83 n/a
5 TRCN0000168620 GTAGCGGAATTAAAGGCTGAA pLKO.1 904 CDS 100% 4.050 2.835 N CEP83 n/a
6 TRCN0000164801 CCTCCCAAAGTACTGGGATTA pLKO.1 1965 3UTR 100% 1.080 0.540 Y MAPKAPK5-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346462.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11953 pDONR223 100% 43.4% 43.3% None (many diffs) n/a
2 ccsbBroad304_11953 pLX_304 0% 43.4% 43.3% V5 (many diffs) n/a
3 TRCN0000474221 AGAGGAAGCCAATAGCGCCGGCAT pLX_317 25.4% 43.4% 43.3% V5 (many diffs) n/a
Download CSV