Transcript: Human NM_001317061.3

Homo sapiens receptor interacting serine/threonine kinase 1 (RIPK1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
RIPK1 (8737)
Length:
4295
CDS:
921..2447

Additional Resources:

NCBI RefSeq record:
NM_001317061.3
NBCI Gene record:
RIPK1 (8737)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001317061.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197069 GTAGTACTCTGGGCGATATTT pLKO.1 1077 CDS 100% 15.000 21.000 N RIPK1 n/a
2 TRCN0000000706 CAGCACAAATACGAACTTCAA pLKO.1 2105 CDS 100% 4.950 6.930 N RIPK1 n/a
3 TRCN0000200006 CGGAACAGATTCTGGTGTCTT pLKO.1 3691 3UTR 100% 4.950 3.960 N RIPK1 n/a
4 TRCN0000342658 CGGAACAGATTCTGGTGTCTT pLKO_005 3691 3UTR 100% 4.950 3.960 N RIPK1 n/a
5 TRCN0000000708 CCTTGTTGATAATGACTTCCA pLKO.1 749 5UTR 100% 2.640 2.112 N RIPK1 n/a
6 TRCN0000196958 GCAGTCTTCAGCCCATTAAAT pLKO.1 3103 3UTR 100% 15.000 10.500 N RIPK1 n/a
7 TRCN0000342657 GCAGTCTTCAGCCCATTAAAT pLKO_005 3103 3UTR 100% 15.000 10.500 N RIPK1 n/a
8 TRCN0000000707 CAGGCCAATTCCAAGTCATAT pLKO.1 1901 CDS 100% 13.200 9.240 N RIPK1 n/a
9 TRCN0000194691 CCAAGCTATCTTTGATAATAC pLKO.1 2147 CDS 100% 13.200 9.240 N RIPK1 n/a
10 TRCN0000195130 CTGTTCCTTGTAGGATGTTTA pLKO.1 3862 3UTR 100% 13.200 9.240 N RIPK1 n/a
11 TRCN0000196606 GCAAAGACCTTACGAGAATTT pLKO.1 1697 CDS 100% 13.200 9.240 N RIPK1 n/a
12 TRCN0000342656 GCAAAGACCTTACGAGAATTT pLKO_005 1697 CDS 100% 13.200 9.240 N RIPK1 n/a
13 TRCN0000194835 CCTACAATTATATGGAGATTG pLKO.1 2059 CDS 100% 10.800 7.560 N RIPK1 n/a
14 TRCN0000199741 GACGCCTCACTTAGTGGATAA pLKO.1 2476 3UTR 100% 10.800 7.560 N RIPK1 n/a
15 TRCN0000352784 GACGCCTCACTTAGTGGATAA pLKO_005 2476 3UTR 100% 10.800 7.560 N RIPK1 n/a
16 TRCN0000000705 AGGTCATGTTCTTTCAGCTTA pLKO.1 2844 3UTR 100% 4.950 3.465 N RIPK1 n/a
17 TRCN0000000709 CTTACAACAGAGAGGAGGAAA pLKO.1 1642 CDS 100% 4.950 3.465 N RIPK1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001317061.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14910 pDONR223 82.3% 75.4% 13.1% None (many diffs) n/a
2 TRCN0000480391 GTAAAGCGGTTGTCTCGACGCCAA pLX_317 19.1% 75.4% 13.1% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroad304_14910 pLX_304 42% 45% 13.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV