Transcript: Human NM_018077.3

Homo sapiens RNA binding motif protein 28 (RBM28), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
RBM28 (55131)
Length:
15507
CDS:
116..2395

Additional Resources:

NCBI RefSeq record:
NM_018077.3
NBCI Gene record:
RBM28 (55131)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_018077.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239463 GGCCGTGGCAAAGGATAAATA pLKO_005 679 CDS 100% 15.000 21.000 N RBM28 n/a
2 TRCN0000239464 ATTCGGAACCTGAGCTTTAAG pLKO_005 467 CDS 100% 13.200 10.560 N RBM28 n/a
3 TRCN0000239462 AGATAAGAAAGCCAGATTAAT pLKO_005 445 CDS 100% 15.000 10.500 N RBM28 n/a
4 TRCN0000239461 CAGTTTGGAGAACTCAAATAT pLKO_005 1184 CDS 100% 15.000 10.500 N RBM28 n/a
5 TRCN0000143059 CGTTAGCCACAAAGAGAAATA pLKO.1 2577 3UTR 100% 13.200 9.240 N RBM28 n/a
6 TRCN0000239465 TGCATATTATCCAGATTATTG pLKO_005 2622 3UTR 100% 13.200 9.240 N RBM28 n/a
7 TRCN0000142682 CCTTTGATGTGTGGTTCGTTA pLKO.1 2561 3UTR 100% 4.950 3.465 N RBM28 n/a
8 TRCN0000142649 GAAGCAGGTAAAGCTCTCAAA pLKO.1 611 CDS 100% 4.950 3.465 N RBM28 n/a
9 TRCN0000102272 GCATTCTAAAGGTTGTGCATT pLKO.1 1234 CDS 100% 4.950 3.465 N Rbm28 n/a
10 TRCN0000140479 GCCCAGTTCATGACTCAAGAA pLKO.1 1256 CDS 100% 4.950 3.465 N RBM28 n/a
11 TRCN0000143650 CTGAAAGTCAACATGATGCTT pLKO.1 2599 3UTR 100% 3.000 2.100 N RBM28 n/a
12 TRCN0000141802 GCTAAGGGAAATAAGACGGAA pLKO.1 2276 CDS 100% 2.640 1.848 N RBM28 n/a
13 TRCN0000139621 CCTCTTGCAAAGAGGAGCAAA pLKO.1 2360 CDS 100% 0.495 0.347 N RBM28 n/a
14 TRCN0000148774 CCATGTGTTCTCATTGTTCAA pLKO.1 15243 3UTR 100% 4.950 2.475 Y GLIPR1L2 n/a
15 TRCN0000162188 CCATGTGTTCTCATTGTTCAA pLKO.1 15243 3UTR 100% 4.950 2.475 Y SPC25 n/a
16 TRCN0000166463 CCTGTGTCCATGTGTTCTCAT pLKO.1 15236 3UTR 100% 4.950 2.475 Y SPC25 n/a
17 TRCN0000255328 CGATGATGATGACGATGATAA pLKO_005 814 CDS 100% 13.200 6.600 Y Sbpl n/a
18 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 8271 3UTR 100% 5.625 2.813 Y KLHL30 n/a
19 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 8072 3UTR 100% 4.950 2.475 Y CCNJL n/a
20 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 3666 3UTR 100% 2.640 1.320 Y LINC01098 n/a
21 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 8271 3UTR 100% 5.625 2.813 Y EID2B n/a
22 TRCN0000168807 GCTGATCTCAAACTCCTGATA pLKO.1 4408 3UTR 100% 4.950 2.475 Y TMEM105 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_018077.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03530 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03530 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470138 GGAGTTGCTAGATCGACCTACCCG pLX_317 17.8% 100% 100% V5 n/a
Download CSV