Transcript: Human NM_001321984.2

Homo sapiens ectonucleoside triphosphate diphosphohydrolase 5 (inactive) (ENTPD5), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ENTPD5 (957)
Length:
2070
CDS:
404..1621

Additional Resources:

NCBI RefSeq record:
NM_001321984.2
NBCI Gene record:
ENTPD5 (957)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001321984.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000229314 GATCCGACGAAGGCATATTAG pLKO_005 909 CDS 100% 13.200 18.480 N ENTPD5 n/a
2 TRCN0000229313 AGCACCTTGTATGGAATTATG pLKO_005 539 CDS 100% 13.200 9.240 N ENTPD5 n/a
3 TRCN0000229315 TCACTTCCTTTGAGATGTTTA pLKO_005 1077 CDS 100% 13.200 9.240 N ENTPD5 n/a
4 TRCN0000050479 GCAGACTTGGTTTGAGGGTAT pLKO.1 481 CDS 100% 4.050 2.835 N ENTPD5 n/a
5 TRCN0000050478 GCCCTGTTAAAGGATGGCTTT pLKO.1 1556 CDS 100% 4.050 2.835 N ENTPD5 n/a
6 TRCN0000050482 GAAGGCATATTAGCTTGGGTT pLKO.1 917 CDS 100% 2.640 1.848 N ENTPD5 n/a
7 TRCN0000050481 GCCAGCACCTTGTATGGAATT pLKO.1 536 CDS 100% 0.000 0.000 N ENTPD5 n/a
8 TRCN0000229316 ATGCTTTCTCTTACTATTATG pLKO_005 1383 CDS 100% 13.200 7.920 N ENTPD5 n/a
9 TRCN0000050480 GCTCTATACACATAGTTACTT pLKO.1 1111 CDS 100% 5.625 3.938 N ENTPD5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001321984.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13825 pDONR223 100% 97.8% 97.7% None (many diffs) n/a
2 ccsbBroad304_13825 pLX_304 0% 97.8% 97.7% V5 (many diffs) n/a
3 TRCN0000472576 CTGATAGGACTATTAAGCTCCGCA pLX_317 31.2% 97.8% 97.7% V5 (many diffs) n/a
4 ccsbBroadEn_15379 pDONR223 0% 94% 93% None (many diffs) n/a
5 ccsbBroad304_15379 pLX_304 0% 94% 93% V5 (many diffs) n/a
Download CSV