Transcript: Human NM_001001973.3

Homo sapiens ATP synthase F1 subunit gamma (ATP5F1C), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
ATP5F1C (509)
Length:
1101
CDS:
32..928

Additional Resources:

NCBI RefSeq record:
NM_001001973.3
NBCI Gene record:
ATP5F1C (509)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001001973.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043450 CGTCAGTCATTGCCCTTGAAT pLKO.1 528 CDS 100% 5.625 4.500 N ATP5F1C n/a
2 TRCN0000290959 CGTCAGTCATTGCCCTTGAAT pLKO_005 528 CDS 100% 5.625 4.500 N ATP5F1C n/a
3 TRCN0000043452 GATCTTTAGCTCTGTATGAAA pLKO.1 246 CDS 100% 5.625 3.938 N ATP5F1C n/a
4 TRCN0000290958 GATCTTTAGCTCTGTATGAAA pLKO_005 246 CDS 100% 5.625 3.938 N ATP5F1C n/a
5 TRCN0000043448 GCTGACAGCATGAGTATCTAT pLKO.1 665 CDS 100% 5.625 3.938 N ATP5F1C n/a
6 TRCN0000290960 GCTGACAGCATGAGTATCTAT pLKO_005 665 CDS 100% 5.625 3.938 N ATP5F1C n/a
7 TRCN0000043449 GCATACTTTATAGGACTCATT pLKO.1 447 CDS 100% 4.950 3.465 N ATP5F1C n/a
8 TRCN0000290957 GCATACTTTATAGGACTCATT pLKO_005 447 CDS 100% 4.950 3.465 N ATP5F1C n/a
9 TRCN0000043451 GCTTCTGAGATGATTGACAAA pLKO.1 821 CDS 100% 4.950 3.465 N ATP5F1C n/a
10 TRCN0000307258 GCTTCTGAGATGATTGACAAA pLKO_005 821 CDS 100% 4.950 3.465 N ATP5F1C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001001973.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00128 pDONR223 100% 100% 100% None n/a
2 TRCN0000479997 ACATTTTCTGGAAAAGGTGGAACC pLX_317 45.5% 100% 100% V5 n/a
3 ccsbBroadEn_05868 pDONR223 100% 99.8% 99.6% None 133A>G n/a
4 ccsbBroad304_05868 pLX_304 0% 99.8% 99.6% V5 133A>G n/a
5 TRCN0000472208 TCTAAATCAGCCCGCTCTACAAAA pLX_317 38.1% 99.8% 99.6% V5 133A>G n/a
Download CSV