Transcript: Human NM_001201404.3

Homo sapiens WASP family member 2 (WASF2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
WASF2 (10163)
Length:
5166
CDS:
226..1071

Additional Resources:

NCBI RefSeq record:
NM_001201404.3
NBCI Gene record:
WASF2 (10163)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001201404.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380976 AGGACGACTGGTCCGATTAAC pLKO_005 1188 3UTR 100% 13.200 18.480 N WASF2 n/a
2 TRCN0000382420 AGCTCTTTACTCAGGCAAATA pLKO_005 383 CDS 100% 13.200 9.240 N WASF2 n/a
3 TRCN0000123073 GTCGACCGACTACAGGTTAAA pLKO.1 439 CDS 100% 13.200 9.240 N WASF2 n/a
4 TRCN0000381211 TCGACCGACTACAGGTTAAAG pLKO_005 440 CDS 100% 13.200 9.240 N WASF2 n/a
5 TRCN0000381783 CCAACATCACCCTGGCAAATG pLKO_005 311 CDS 100% 10.800 7.560 N WASF2 n/a
6 TRCN0000379885 CCACTTTGGTGTACCAGAATG pLKO_005 902 CDS 100% 10.800 7.560 N WASF2 n/a
7 TRCN0000123072 CCTGTCTTAGAAACATACAAT pLKO.1 580 CDS 100% 5.625 3.938 N WASF2 n/a
8 TRCN0000123069 GCCATATTCAACTACAGCCTT pLKO.1 1544 3UTR 100% 2.640 1.848 N WASF2 n/a
9 TRCN0000382403 TCCTCCAAGTCAACATGTATT pLKO_005 1365 3UTR 100% 13.200 7.920 N WASF2 n/a
10 TRCN0000379527 CAGACCCTTCATACTTCTTTG pLKO_005 677 CDS 100% 10.800 6.480 N WASF2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001201404.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489333 TCGACCAGCTTGAAATACATCAAC pLX_317 20.2% 55.8% 55% V5 (many diffs) n/a
2 TRCN0000488050 ACCCCCATTTCCCACGAATCATAG pLX_317 20.6% 55.8% 55% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV