Transcript: Human NR_103997.2

Homo sapiens serine/threonine kinase like domain containing 1 (STKLD1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
STKLD1 (169436)
Length:
3399
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_103997.2
NBCI Gene record:
STKLD1 (169436)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_103997.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195317 CACTCCTCTTAGGTGACTAAT pLKO.1 3180 3UTR 100% 13.200 18.480 N STKLD1 n/a
2 TRCN0000082449 CTCGGATCGAATAACGATAAA pLKO.1 2018 3UTR 100% 13.200 18.480 N STKLD1 n/a
3 TRCN0000037436 CCTCGGATCGAATAACGATAA pLKO.1 2017 3UTR 100% 10.800 15.120 N STKLD1 n/a
4 TRCN0000037437 GCTGGTGTCCAGTAGTATGAA pLKO.1 2571 3UTR 100% 5.625 3.938 N STKLD1 n/a
5 TRCN0000195524 CCATGGAGAAGTACCAGGTTT pLKO.1 179 3UTR 100% 4.950 3.465 N STKLD1 n/a
6 TRCN0000037435 CCTGCACCATTTGGACATCAT pLKO.1 1729 3UTR 100% 4.950 3.465 N STKLD1 n/a
7 TRCN0000195169 CCTTAATCATTTCTGGCAAGA pLKO.1 3225 3UTR 100% 4.050 2.835 N STKLD1 n/a
8 TRCN0000082451 GCATGTGATAAAGCAGGTGGA pLKO.1 267 3UTR 100% 2.160 1.512 N STKLD1 n/a
9 TRCN0000082448 CCTTCCAGGAACTGGTTTCTT pLKO.1 2950 3UTR 100% 5.625 3.375 N STKLD1 n/a
10 TRCN0000037434 CCTGAAGACAATGGAGGAGAA pLKO.1 1937 3UTR 100% 4.050 2.430 N STKLD1 n/a
11 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 626 3UTR 100% 4.950 2.475 Y LOC387873 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_103997.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491440 CAGCCTCTGCTGTACTATCGTAAG pLX_317 18.8% 39.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV