Transcript: Human NM_001284355.3

Homo sapiens archaelysin family metallopeptidase 1 (AMZ1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
AMZ1 (155185)
Length:
5291
CDS:
314..1207

Additional Resources:

NCBI RefSeq record:
NM_001284355.3
NBCI Gene record:
AMZ1 (155185)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001284355.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147233 GTCCTTCTTGAAGAACAACAA pLKO.1 796 CDS 100% 4.950 6.930 N AMZ1 n/a
2 TRCN0000421035 TGGGTTTCAGGCTCATCGAGA pLKO_005 1063 CDS 100% 2.640 3.696 N AMZ1 n/a
3 TRCN0000149779 GCTCAGAAGTAGCATTAGGAT pLKO.1 3188 3UTR 100% 3.000 2.400 N AMZ1 n/a
4 TRCN0000148604 CGTTTGATCTGTCTCCCTTTA pLKO.1 2737 3UTR 100% 10.800 7.560 N AMZ1 n/a
5 TRCN0000148572 CTGCACTTTGAAGCTCCTTTA pLKO.1 2778 3UTR 100% 10.800 7.560 N AMZ1 n/a
6 TRCN0000148353 CCTGTCCTTCTTGAAGAACAA pLKO.1 793 CDS 100% 4.950 3.465 N AMZ1 n/a
7 TRCN0000149457 GCCTGCCCTTCAGTTATTTAT pLKO.1 2235 3UTR 100% 15.000 9.000 N AMZ1 n/a
8 TRCN0000436732 TGACCTGCCAGGGATAAAGAG pLKO_005 1714 3UTR 100% 4.950 2.970 N AMZ1 n/a
9 TRCN0000429283 TTGAGAGGCCAGGAGTTTGAG pLKO_005 1780 3UTR 100% 4.950 2.970 N AMZ1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001284355.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05088 pDONR223 100% 59.6% 44.6% None 600_601ins170;891_892ins433 n/a
2 ccsbBroad304_05088 pLX_304 0% 59.6% 44.6% V5 600_601ins170;891_892ins433 n/a
3 TRCN0000476173 GCTCCAGGTTCCCAACCGATCTTC pLX_317 20.1% 59.6% 44.6% V5 600_601ins170;891_892ins433 n/a
Download CSV