Transcript: Mouse XM_030246641.1

PREDICTED: Mus musculus ArfGAP with SH3 domain, ankyrin repeat and PH domain 2 (Asap2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Asap2 (211914)
Length:
5575
CDS:
539..3196

Additional Resources:

NCBI RefSeq record:
XM_030246641.1
NBCI Gene record:
Asap2 (211914)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030246641.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381311 CCCATGTTCACGTCGAGTATG pLKO_005 2241 CDS 100% 10.800 15.120 N Asap2 n/a
2 TRCN0000382176 CTTAGCCCAATTCCGACATTG pLKO_005 3536 3UTR 100% 10.800 15.120 N Asap2 n/a
3 TRCN0000103985 CGCATCTGTATCATCGGTCTT pLKO.1 4924 3UTR 100% 4.050 3.240 N Asap2 n/a
4 TRCN0000103988 GCCCTTTGATAAAGCTTGGAA pLKO.1 616 CDS 100% 3.000 2.400 N Asap2 n/a
5 TRCN0000379874 ACGAACAAGAATGTCAGATAT pLKO_005 1335 CDS 100% 13.200 9.240 N Asap2 n/a
6 TRCN0000380121 AGCTCTGAACAACGCCTTTAA pLKO_005 1387 CDS 100% 13.200 9.240 N Asap2 n/a
7 TRCN0000381827 AGTACCTGCTGAAGGTCAATG pLKO_005 783 CDS 100% 10.800 7.560 N Asap2 n/a
8 TRCN0000029752 CCCTTTGGACAGTTTGCTGAA pLKO.1 559 CDS 100% 4.050 2.835 N ASAP2 n/a
9 TRCN0000103986 GCCTCCATTGAGATAGCCAAT pLKO.1 2126 CDS 100% 4.050 2.835 N Asap2 n/a
10 TRCN0000103989 GAAATTATGGAGTGTTGCCTA pLKO.1 1688 CDS 100% 2.640 1.848 N Asap2 n/a
11 TRCN0000093246 CGAGACCCATGAGGACTACAA pLKO.1 366 5UTR 100% 4.950 2.475 Y 1700030C10Rik n/a
12 TRCN0000243553 GAGACCCATGAGGACTACAAG pLKO_005 367 5UTR 100% 4.950 2.475 Y Gm9222 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030246641.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07314 pDONR223 100% 71.9% 78.5% None (many diffs) n/a
2 ccsbBroad304_07314 pLX_304 0% 71.9% 78.5% V5 (many diffs) n/a
3 TRCN0000465586 TGACTTTAATCGCTTTACTTAGAA pLX_317 12.1% 71.9% 78.5% V5 (many diffs) n/a
Download CSV