Transcript: Mouse NM_001368863.1

Mus musculus LIM and calponin homology domains 1 (Limch1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Mus musculus (mouse)
Gene:
Limch1 (77569)
Length:
6244
CDS:
650..3346

Additional Resources:

NCBI RefSeq record:
NM_001368863.1
NBCI Gene record:
Limch1 (77569)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001368863.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108670 CCGGAGACATTTGTGTTACTT pLKO.1 3894 3UTR 100% 5.625 4.500 N Limch1 n/a
2 TRCN0000108673 CCATTGCAGGATTGGACAATA pLKO.1 396 5UTR 100% 13.200 9.240 N Limch1 n/a
3 TRCN0000108671 CCCTGAAATCTCCGTGTCAAA pLKO.1 2887 CDS 100% 4.950 3.465 N Limch1 n/a
4 TRCN0000108672 CGGATTCTCCAAGCAGTGAAA pLKO.1 2418 CDS 100% 4.950 3.465 N Limch1 n/a
5 TRCN0000108674 GAGCACGAGTATGTTTGACAT pLKO.1 1144 CDS 100% 4.950 3.465 N Limch1 n/a
6 TRCN0000153260 GCCATTCAACAGAGCCAAATT pLKO.1 1578 CDS 100% 13.200 9.240 N LIMCH1 n/a
7 TRCN0000344247 GCCATTCAACAGAGCCAAATT pLKO_005 1578 CDS 100% 13.200 9.240 N LIMCH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001368863.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11657 pDONR223 100% 15.1% 16.3% None (many diffs) n/a
2 ccsbBroad304_11657 pLX_304 0% 15.1% 16.3% V5 (many diffs) n/a
3 TRCN0000469060 CAGATCAGGCACCAGCCCCTGCAA pLX_317 60% 15.1% 16.3% V5 (many diffs) n/a
Download CSV