Transcript: Human XM_005246449.1

PREDICTED: Homo sapiens polypeptide N-acetylgalactosaminyltransferase 3 (GALNT3), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GALNT3 (2591)
Length:
3415
CDS:
536..2437

Additional Resources:

NCBI RefSeq record:
XM_005246449.1
NBCI Gene record:
GALNT3 (2591)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005246449.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000035455 CCAGACCTTAATCCTGTTATA pLKO.1 2030 CDS 100% 13.200 10.560 N GALNT3 n/a
2 TRCN0000035457 GCTGTCGTAAGTCCAGATATT pLKO.1 1433 CDS 100% 13.200 9.240 N GALNT3 n/a
3 TRCN0000288759 GCTGTCGTAAGTCCAGATATT pLKO_005 1433 CDS 100% 13.200 9.240 N GALNT3 n/a
4 TRCN0000035456 GCTCACTGTGAGTGTTTCTAT pLKO.1 1367 CDS 100% 5.625 3.938 N GALNT3 n/a
5 TRCN0000288830 GCTCACTGTGAGTGTTTCTAT pLKO_005 1367 CDS 100% 5.625 3.938 N GALNT3 n/a
6 TRCN0000035454 GCTCTATTCTTCACCTGCAAT pLKO.1 1159 CDS 100% 4.950 3.465 N GALNT3 n/a
7 TRCN0000306985 GCTCTATTCTTCACCTGCAAT pLKO_005 1159 CDS 100% 4.950 3.465 N GALNT3 n/a
8 TRCN0000035458 GCAGAATTGAAGCCTGTCCTT pLKO.1 848 CDS 100% 2.640 1.848 N GALNT3 n/a
9 TRCN0000288829 GCAGAATTGAAGCCTGTCCTT pLKO_005 848 CDS 100% 2.640 1.848 N GALNT3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005246449.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00613 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00613 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471154 AATTATGGTTGCATTTCTCCAATC pLX_317 24.2% 100% 100% V5 n/a
4 ccsbBroadEn_10836 pDONR223 100% 21% 19.5% None (many diffs) n/a
5 ccsbBroad304_10836 pLX_304 0% 21% 19.5% V5 (many diffs) n/a
Download CSV