Transcript: Human XM_005246640.2

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase 20 (MAP3K20), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K20 (51776)
Length:
2684
CDS:
247..2649

Additional Resources:

NCBI RefSeq record:
XM_005246640.2
NBCI Gene record:
MAP3K20 (51776)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145178 TGTATGGTTATGGAACCGAG pXPR_003 AGG 466 19% 7 0.7307 MAP3K20 MAP3K20 75596
2 BRDN0001146540 GCTTGTAGTGGAAAAAAACG pXPR_003 AGG 664 28% 8 0.6655 MAP3K20, MAP3K20-AS1 MAP3K20 75597
3 BRDN0001146874 GTGACAATGCCATAGTTGGG pXPR_003 AGG 228 9% 3 0.4716 MAP3K20 MAP3K20 75598
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005246640.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195395 CGTTCCCAGAGCAATCCTATT pLKO.1 2014 CDS 100% 10.800 15.120 N MAP3K20 n/a
2 TRCN0000003267 ACGAGAGATTAACCATTCCAA pLKO.1 911 CDS 100% 3.000 4.200 N MAP3K20 n/a
3 TRCN0000342566 ACGAGAGATTAACCATTCCAA pLKO_005 911 CDS 100% 3.000 4.200 N MAP3K20 n/a
4 TRCN0000196754 GATGTGACATTCAACACTAAC pLKO.1 1669 CDS 100% 10.800 8.640 N MAP3K20 n/a
5 TRCN0000322188 CAAGTCAAGAAACGTTGTTAT pLKO_005 648 CDS 100% 13.200 9.240 N Map3k20 n/a
6 TRCN0000195071 CAGAAACTTGTGACACATATT pLKO.1 797 CDS 100% 13.200 9.240 N MAP3K20 n/a
7 TRCN0000003268 CCATAACCATACAACACACAT pLKO.1 717 CDS 100% 4.950 3.465 N MAP3K20 n/a
8 TRCN0000342617 CCATAACCATACAACACACAT pLKO_005 717 CDS 100% 4.950 3.465 N MAP3K20 n/a
9 TRCN0000003266 CCTCAGTCACAGAAACATCAT pLKO.1 423 CDS 100% 4.950 3.465 N MAP3K20 n/a
10 TRCN0000352644 CCTCAGTCACAGAAACATCAT pLKO_005 423 CDS 100% 4.950 3.465 N MAP3K20 n/a
11 TRCN0000196862 GCCCATTAAGTATCAACAGAT pLKO.1 2106 CDS 100% 4.950 3.465 N MAP3K20 n/a
12 TRCN0000003265 GCTTCTCTGGGATCACTCTAT pLKO.1 499 CDS 100% 4.950 3.465 N MAP3K20 n/a
13 TRCN0000342564 GCTTCTCTGGGATCACTCTAT pLKO_005 499 CDS 100% 4.950 3.465 N MAP3K20 n/a
14 TRCN0000195308 CGAGCCAAATGGATATCACAG pLKO.1 340 CDS 100% 4.050 2.835 N MAP3K20 n/a
15 TRCN0000003264 ACAGTAACAGAAGTGAGGAGA pLKO.1 530 CDS 100% 2.640 1.848 N MAP3K20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005246640.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492308 CTGCATTGCCGATATCTGGATTAT pLX_317 34% 49.9% 44.6% V5 (many diffs) n/a
2 ccsbBroadEn_03382 pDONR223 100% 49.7% 44.6% None (many diffs) n/a
3 ccsbBroad304_03382 pLX_304 0% 49.7% 44.6% V5 (many diffs) n/a
4 TRCN0000473777 CTCAGGTTCCCCGAGCCGGTACAA pLX_317 36.3% 49.7% 44.6% V5 (many diffs) n/a
5 ccsbBroadEn_15075 pDONR223 0% 49.7% 44.6% None (many diffs) n/a
6 ccsbBroad304_15075 pLX_304 0% 49.7% 44.6% V5 (many diffs) n/a
7 TRCN0000472501 AAAAAGCCCACAAAACCTTACCCA pLX_317 30.5% 49.7% 44.6% V5 (many diffs) n/a
8 TRCN0000487828 GCGGTGCAAGTAACACGGGGCACT pLX_317 20.2% 49.7% 44.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV