Transcript: Human XM_005248174.2

PREDICTED: Homo sapiens phosphatidylinositol 4-kinase type 2 beta (PI4K2B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PI4K2B (55300)
Length:
3457
CDS:
122..1552

Additional Resources:

NCBI RefSeq record:
XM_005248174.2
NBCI Gene record:
PI4K2B (55300)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248174.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194997 CATCTGAGCATTGTACCTAAA pLKO.1 719 CDS 100% 10.800 15.120 N PI4K2B n/a
2 TRCN0000195735 CAGTAACTATTGGTACTTCAG pLKO.1 387 CDS 100% 4.050 5.670 N PI4K2B n/a
3 TRCN0000037587 GCTGCAATTGATAATGGTCTA pLKO.1 1127 CDS 100% 4.050 5.670 N PI4K2B n/a
4 TRCN0000217963 GAATGGAGAGCATATCCATTT pLKO_005 1172 CDS 100% 1.080 1.512 N PI4K2B n/a
5 TRCN0000229847 ACTCCTAAAGTGACCATTATT pLKO_005 2054 3UTR 100% 15.000 12.000 N PI4K2B n/a
6 TRCN0000196629 GTACTGGCCTTGTTCAATTTA pLKO.1 2344 3UTR 100% 15.000 10.500 N PI4K2B n/a
7 TRCN0000195310 CAAGGTTCAAGTGGAAGTTAC pLKO.1 503 CDS 100% 10.800 7.560 N PI4K2B n/a
8 TRCN0000229845 CCGCGGTTTCAGTAACTATTG pLKO_005 378 CDS 100% 10.800 7.560 N PI4K2B n/a
9 TRCN0000195443 CCTGATGAATGGAGAGCATAT pLKO.1 1166 CDS 100% 10.800 7.560 N PI4K2B n/a
10 TRCN0000196488 GAGAAGAATGTTCATGCTAAT pLKO.1 1882 3UTR 100% 10.800 7.560 N PI4K2B n/a
11 TRCN0000037586 CCTTTCCAGCTAGTACAGATA pLKO.1 1418 CDS 100% 4.950 3.465 N PI4K2B n/a
12 TRCN0000037588 GACATGAACTTTGTGCAAGAT pLKO.1 1268 CDS 100% 4.950 3.465 N PI4K2B n/a
13 TRCN0000196628 GCAAGATTTATGTGAAGATCT pLKO.1 1282 CDS 100% 4.950 3.465 N PI4K2B n/a
14 TRCN0000194791 CAATGATAATTGGTTAGTCAG pLKO.1 1024 CDS 100% 4.050 2.835 N PI4K2B n/a
15 TRCN0000218617 ATGGACCAAATATGTCCATAA pLKO_005 604 CDS 100% 1.080 0.756 N PI4K2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248174.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08508 pDONR223 100% 98.7% 98.7% None (many diffs) n/a
2 ccsbBroad304_08508 pLX_304 0% 98.7% 98.7% V5 (many diffs) n/a
3 TRCN0000489163 CCTCCTGGGCGGCACTGTCAAACC pLX_317 20.3% 98.7% 98.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_15094 pDONR223 100% 97.5% 48.9% None (many diffs) n/a
5 ccsbBroad304_15094 pLX_304 0% 97.5% 48.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000466718 TGTCTCCGGACCTAACTAATTTTC pLX_317 22.5% 97.5% 48.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV