Transcript: Human XM_005248175.4

PREDICTED: Homo sapiens phosphatidylinositol 4-kinase type 2 beta (PI4K2B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PI4K2B (55300)
Length:
3262
CDS:
200..1357

Additional Resources:

NCBI RefSeq record:
XM_005248175.4
NBCI Gene record:
PI4K2B (55300)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001147844 GCTGCCTGATTCCTAATCAG pXPR_003 GGG 261 23% 3 0.7581 PI4K2B PI4K2B 77132
2 BRDN0001149133 CTTTGTGAAGGATCCTAAGA pXPR_003 GGG 130 11% 2 0.0289 PI4K2B PI4K2B 77133
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248175.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194997 CATCTGAGCATTGTACCTAAA pLKO.1 509 CDS 100% 10.800 15.120 N PI4K2B n/a
2 TRCN0000037587 GCTGCAATTGATAATGGTCTA pLKO.1 932 CDS 100% 4.050 5.670 N PI4K2B n/a
3 TRCN0000217963 GAATGGAGAGCATATCCATTT pLKO_005 977 CDS 100% 1.080 1.512 N PI4K2B n/a
4 TRCN0000229847 ACTCCTAAAGTGACCATTATT pLKO_005 1859 3UTR 100% 15.000 12.000 N PI4K2B n/a
5 TRCN0000037585 CCCTCCTAAGATTGGTTCCTT pLKO.1 658 CDS 100% 3.000 2.400 N PI4K2B n/a
6 TRCN0000196629 GTACTGGCCTTGTTCAATTTA pLKO.1 2149 3UTR 100% 15.000 10.500 N PI4K2B n/a
7 TRCN0000196739 GATTGGTTCCTTTCAGTTATT pLKO.1 667 CDS 100% 13.200 9.240 N PI4K2B n/a
8 TRCN0000195310 CAAGGTTCAAGTGGAAGTTAC pLKO.1 293 CDS 100% 10.800 7.560 N PI4K2B n/a
9 TRCN0000195443 CCTGATGAATGGAGAGCATAT pLKO.1 971 CDS 100% 10.800 7.560 N PI4K2B n/a
10 TRCN0000196488 GAGAAGAATGTTCATGCTAAT pLKO.1 1687 3UTR 100% 10.800 7.560 N PI4K2B n/a
11 TRCN0000037586 CCTTTCCAGCTAGTACAGATA pLKO.1 1223 CDS 100% 4.950 3.465 N PI4K2B n/a
12 TRCN0000037588 GACATGAACTTTGTGCAAGAT pLKO.1 1073 CDS 100% 4.950 3.465 N PI4K2B n/a
13 TRCN0000196628 GCAAGATTTATGTGAAGATCT pLKO.1 1087 CDS 100% 4.950 3.465 N PI4K2B n/a
14 TRCN0000194791 CAATGATAATTGGTTAGTCAG pLKO.1 829 CDS 100% 4.050 2.835 N PI4K2B n/a
15 TRCN0000218617 ATGGACCAAATATGTCCATAA pLKO_005 394 CDS 100% 1.080 0.756 N PI4K2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248175.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08508 pDONR223 100% 79.9% 80% None 0_1ins288;33C>T;45G>A n/a
2 ccsbBroad304_08508 pLX_304 0% 79.9% 80% V5 0_1ins288;33C>T;45G>A n/a
3 TRCN0000489163 CCTCCTGGGCGGCACTGTCAAACC pLX_317 20.3% 79.9% 80% V5 (not translated due to prior stop codon) 0_1ins288;33C>T;885T>C n/a
4 ccsbBroadEn_15094 pDONR223 100% 78.6% 28.9% None (many diffs) n/a
5 ccsbBroad304_15094 pLX_304 0% 78.6% 28.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000466718 TGTCTCCGGACCTAACTAATTTTC pLX_317 22.5% 78.6% 28.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV