Transcript: Human XM_005248474.4

PREDICTED: Homo sapiens peptidylprolyl isomerase domain and WD repeat containing 1 (PPWD1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPWD1 (23398)
Length:
1337
CDS:
144..1184

Additional Resources:

NCBI RefSeq record:
XM_005248474.4
NBCI Gene record:
PPWD1 (23398)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005248474.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415117 GCATACATTTCACCGTATAAT pLKO_005 833 CDS 100% 15.000 21.000 N PPWD1 n/a
2 TRCN0000432375 CCAACGCCTTGGCTTGATAAT pLKO_005 1035 CDS 100% 13.200 18.480 N PPWD1 n/a
3 TRCN0000436917 CCAACGCCTTGGCTTGATAAT pLKO_005 1035 CDS 100% 13.200 18.480 N Ppwd1 n/a
4 TRCN0000423475 TGAAGGACCTAAACGAGTTTC pLKO_005 695 CDS 100% 10.800 15.120 N PPWD1 n/a
5 TRCN0000000168 ACATGGAATTTGGCCGACGAA pLKO.1 253 CDS 100% 2.640 3.696 N PPWD1 n/a
6 TRCN0000000165 GCTTAGGACTTGCTGAATATA pLKO.1 1253 3UTR 100% 15.000 12.000 N PPWD1 n/a
7 TRCN0000429423 TGAGGATGTCAGCATCATAAA pLKO_005 1148 CDS 100% 13.200 9.240 N PPWD1 n/a
8 TRCN0000000167 CCAAACGAGAACCAGAAGATA pLKO.1 598 CDS 100% 5.625 3.938 N PPWD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005248474.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07877 pDONR223 100% 52% 49.3% None (many diffs) n/a
2 ccsbBroad304_07877 pLX_304 0% 52% 49.3% V5 (many diffs) n/a
3 TRCN0000469442 AGGGGGAGCGCTACCATCTCATTG pLX_317 20.9% 52% 49.3% V5 (many diffs) n/a
4 TRCN0000488931 TTCGGCTCCACCTACGGTCTATAA pLX_317 16.3% 52% 49.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV