Transcript: Human XM_005250306.2

PREDICTED: Homo sapiens ArfGAP with FG repeats 2 (AGFG2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AGFG2 (3268)
Length:
4830
CDS:
123..1601

Additional Resources:

NCBI RefSeq record:
XM_005250306.2
NBCI Gene record:
AGFG2 (3268)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005250306.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000427141 GACTTAGGATCAGCCAAGTTG pLKO_005 1470 CDS 100% 4.950 6.930 N AGFG2 n/a
2 TRCN0000149837 CGGACATCTTTAGTACCAGAT pLKO.1 474 CDS 100% 4.050 5.670 N AGFG2 n/a
3 TRCN0000147372 GTCAATCTCCATGACAACTTT pLKO.1 374 CDS 100% 5.625 3.938 N AGFG2 n/a
4 TRCN0000419486 TGAGAAGAAGAGATGGTATGT pLKO_005 539 CDS 100% 4.950 3.465 N AGFG2 n/a
5 TRCN0000146397 CCAACTTTGATGCCTTTAGCA pLKO.1 901 CDS 100% 3.000 2.100 N AGFG2 n/a
6 TRCN0000148766 CCTGAAGTAGTATTCCTGCAA pLKO.1 402 CDS 100% 2.640 1.848 N AGFG2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005250306.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06400 pDONR223 100% 96.6% 96.5% None 877_909del;1079T>C;1462_1476del n/a
2 ccsbBroad304_06400 pLX_304 0% 96.6% 96.5% V5 877_909del;1079T>C;1462_1476del n/a
3 TRCN0000480883 CCTAAAGTTGCGACTCTAATAAGT pLX_317 30.9% 96.6% 67.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_13875 pDONR223 100% 30.3% 29.2% None (many diffs) n/a
5 ccsbBroad304_13875 pLX_304 0% 30.3% 29.2% V5 (many diffs) n/a
6 TRCN0000479605 CACTTCATTTGTATTATAGTATAT pLX_317 82.6% 30.3% 29.2% V5 (many diffs) n/a
Download CSV