Transcript: Human XM_005251239.2

PREDICTED: Homo sapiens aspartate beta-hydroxylase (ASPH), transcript variant X17, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ASPH (444)
Length:
5306
CDS:
239..2503

Additional Resources:

NCBI RefSeq record:
XM_005251239.2
NBCI Gene record:
ASPH (444)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000053359 CGCTCACTCTACAATGTGAAT pLKO.1 1910 CDS 100% 4.950 6.930 N ASPH n/a
2 TRCN0000053362 CGTGGTTTATGGTGATTGCAT pLKO.1 405 CDS 100% 3.000 4.200 N ASPH n/a
3 TRCN0000310510 CGTGGTTTATGGTGATTGCAT pLKO_005 405 CDS 100% 3.000 4.200 N ASPH n/a
4 TRCN0000053358 CGGCTGATATTCATCGTGGAT pLKO.1 2429 CDS 100% 2.640 3.696 N ASPH n/a
5 TRCN0000303762 ACGCAGCCTTCCAGCAATTTA pLKO_005 2482 CDS 100% 15.000 10.500 N ASPH n/a
6 TRCN0000303761 TGGGAACAAAGAGGCATATAA pLKO_005 1840 CDS 100% 15.000 10.500 N ASPH n/a
7 TRCN0000303760 GGGCTACACAGAGTTAGTAAA pLKO_005 1969 CDS 100% 13.200 9.240 N ASPH n/a
8 TRCN0000331331 TGACTTGCAGCCCGAGTAATT pLKO_005 2608 3UTR 100% 13.200 9.240 N ASPH n/a
9 TRCN0000053361 CCCATATTTAAAGGAAGGAAT pLKO.1 1750 CDS 100% 4.950 3.465 N ASPH n/a
10 TRCN0000053360 CCTGAGGATAATCCTGTAGAA pLKO.1 1073 CDS 100% 4.950 3.465 N ASPH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00115 pDONR223 100% 34.5% 32.3% None (many diffs) n/a
2 ccsbBroad304_00115 pLX_304 0% 34.5% 32.3% V5 (many diffs) n/a
3 TRCN0000468251 ACTATCGGAACGAACTTGACCCCG pLX_317 44.4% 34.5% 32.3% V5 (many diffs) n/a
4 ccsbBroadEn_15361 pDONR223 0% 23.1% 19.3% None (many diffs) n/a
5 ccsbBroad304_15361 pLX_304 0% 23.1% 19.3% V5 (many diffs) n/a
6 TRCN0000480274 ATCGAGGCCAAGAGTAGCCAAATT pLX_317 63.5% 23.1% 19.3% V5 (many diffs) n/a
Download CSV