Transcript: Human XM_005251563.2

PREDICTED: Homo sapiens TEK receptor tyrosine kinase (TEK), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TEK (7010)
Length:
4326
CDS:
142..3384

Additional Resources:

NCBI RefSeq record:
XM_005251563.2
NBCI Gene record:
TEK (7010)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251563.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356282 GTGTACTCGGCCAGGTATATA pLKO_005 703 CDS 100% 15.000 21.000 N TEK n/a
2 TRCN0000000413 GCTACCTACTAATGAAGAAAT pLKO.1 1140 CDS 100% 13.200 18.480 N TEK n/a
3 TRCN0000356218 TACGTGAATACCACGCTTTAT pLKO_005 3313 CDS 100% 13.200 18.480 N TEK n/a
4 TRCN0000000414 CGCTACCTACTAATGAAGAAA pLKO.1 1139 CDS 100% 5.625 7.875 N TEK n/a
5 TRCN0000000415 GCTTCTATACAAACCCGTTAA pLKO.1 1452 CDS 100% 10.800 8.640 N TEK n/a
6 TRCN0000356278 CGTGAGTACAATTAGTATAAT pLKO_005 3671 3UTR 100% 15.000 10.500 N TEK n/a
7 TRCN0000378503 CCGGCATGAAGTACCTGATAT pLKO_005 639 CDS 100% 13.200 9.240 N Tek n/a
8 TRCN0000195300 CCTCCTCCAAGAGGTCTAAAT pLKO.1 1642 CDS 100% 13.200 9.240 N TEK n/a
9 TRCN0000000416 CCTACCAGCTACTTTAACTAT pLKO.1 513 CDS 100% 5.625 3.938 N TEK n/a
10 TRCN0000023554 CGCATCAAGAAGGATGGGTTA pLKO.1 2533 CDS 100% 4.050 2.835 N Tek n/a
11 TRCN0000000412 TGGGTGACATTTGGGAGACAT pLKO.1 4153 3UTR 100% 4.950 2.970 N TEK n/a
12 TRCN0000023557 GCCTTAATGAACCAGCACCAA pLKO.1 328 CDS 100% 2.640 2.112 N Tek n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251563.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000491252 ACTCGGAAAATATGCCAGGCTATC pLX_317 23.4% 28% .1% V5 (not translated due to prior stop codon) 1_2332del n/a
Download CSV