Transcript: Human XM_005251731.4

PREDICTED: Homo sapiens RAS and EF-hand domain containing (RASEF), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RASEF (158158)
Length:
6058
CDS:
1135..2970

Additional Resources:

NCBI RefSeq record:
XM_005251731.4
NBCI Gene record:
RASEF (158158)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251731.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055625 GCAGAACATAAGACACGGAAA pLKO.1 1393 CDS 100% 4.050 5.670 N RASEF n/a
2 TRCN0000427814 GATCTGCAGGTGACCATTAAA pLKO_005 1480 CDS 100% 15.000 10.500 N RASEF n/a
3 TRCN0000415020 AGCAAGTTCAACAGATCTTTG pLKO_005 1840 CDS 100% 10.800 7.560 N RASEF n/a
4 TRCN0000423606 CAGATCCATTACCAATCTAAC pLKO_005 2898 CDS 100% 10.800 7.560 N RASEF n/a
5 TRCN0000055624 CCCATGAGACTGTTCCCATTA pLKO.1 2675 CDS 100% 10.800 7.560 N RASEF n/a
6 TRCN0000055623 GCCTTTCTTCAGAGTGAGTTA pLKO.1 1639 CDS 100% 4.950 3.465 N RASEF n/a
7 TRCN0000055626 GCTTTCTTAACATACGAGAAT pLKO.1 2630 CDS 100% 4.950 3.465 N RASEF n/a
8 TRCN0000055627 GCCAAGATTAATTCAGCCATA pLKO.1 1224 CDS 100% 4.050 2.835 N RASEF n/a
9 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 402 5UTR 100% 1.080 0.540 Y GPR83 n/a
10 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 402 5UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251731.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05093 pDONR223 100% 82% 81.3% None (many diffs) n/a
2 ccsbBroad304_05093 pLX_304 0% 82% 81.3% V5 (many diffs) n/a
3 TRCN0000480544 AAGGCCCGCTTACATGCTCTCGCT pLX_317 18.1% 82% 81.3% V5 (many diffs) n/a
Download CSV