Transcript: Human XM_005252588.4

PREDICTED: Homo sapiens calcium voltage-gated channel auxiliary subunit beta 2 (CACNB2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CACNB2 (783)
Length:
8339
CDS:
458..2182

Additional Resources:

NCBI RefSeq record:
XM_005252588.4
NBCI Gene record:
CACNB2 (783)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005252588.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422285 AGCAGCGCAGCCGTCATAAAT pLKO_005 2067 CDS 100% 15.000 21.000 N CACNB2 n/a
2 TRCN0000043873 GCCGTACATTAGCCACTTCAA pLKO.1 1629 CDS 100% 4.950 6.930 N CACNB2 n/a
3 TRCN0000043874 CGGTATTAAACAATCCCAGTA pLKO.1 1191 CDS 100% 4.050 5.670 N CACNB2 n/a
4 TRCN0000043875 CGAGGGAAATCTCAAGCTAAA pLKO.1 1430 CDS 100% 10.800 8.640 N CACNB2 n/a
5 TRCN0000413535 GTGGATAGGGCGATTGGTAAA pLKO_005 787 CDS 100% 10.800 8.640 N CACNB2 n/a
6 TRCN0000043877 CGCAATAATAGAAAGATCCAA pLKO.1 1216 CDS 100% 3.000 2.400 N CACNB2 n/a
7 TRCN0000043876 CCAGTAAATCAGGAGGAAATT pLKO.1 903 CDS 100% 13.200 9.240 N CACNB2 n/a
8 TRCN0000422085 ACAGATTTGAAGGGCGGATAT pLKO_005 1128 CDS 100% 10.800 7.560 N CACNB2 n/a
9 TRCN0000069107 CCCAAGCTGAAGAAGAACCTT pLKO.1 1740 CDS 100% 3.000 2.100 N Cacnb2 n/a
10 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4223 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005252588.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000475910 GCTCCATTGATGAATATAAACAAC pLX_317 14.6% 85.3% 84.2% V5 (many diffs) n/a
2 ccsbBroadEn_05924 pDONR223 100% 85.3% 84% None (many diffs) n/a
3 ccsbBroad304_05924 pLX_304 0% 85.3% 84% V5 (many diffs) n/a
Download CSV