Transcript: Human XM_005254538.2

PREDICTED: Homo sapiens mitogen-activated protein kinase 6 (MAPK6), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAPK6 (5597)
Length:
4222
CDS:
792..2957

Additional Resources:

NCBI RefSeq record:
XM_005254538.2
NBCI Gene record:
MAPK6 (5597)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005254538.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001568 GCTGTCCACGTACTTAATTTA pLKO.1 3774 3UTR 100% 15.000 21.000 N MAPK6 n/a
2 TRCN0000001571 GCTCTCTTACGGAACTGAACA pLKO.1 1078 CDS 100% 4.950 6.930 N MAPK6 n/a
3 TRCN0000195285 CCAGCGTTTATTGTAGTAAAC pLKO.1 3519 3UTR 100% 1.080 1.512 N MAPK6 n/a
4 TRCN0000315206 CCAGCGTTTATTGTAGTAAAC pLKO_005 3519 3UTR 100% 1.080 1.512 N MAPK6 n/a
5 TRCN0000194711 CACTAGTTACTTGGACAAGTT pLKO.1 2666 CDS 100% 0.000 0.000 N MAPK6 n/a
6 TRCN0000315272 CACTAGTTACTTGGACAAGTT pLKO_005 2666 CDS 100% 0.000 0.000 N MAPK6 n/a
7 TRCN0000315207 ATCCTTACATGAGCATATATT pLKO_005 1729 CDS 100% 15.000 10.500 N MAPK6 n/a
8 TRCN0000195172 CATCCTTACATGAGCATATAT pLKO.1 1728 CDS 100% 15.000 10.500 N MAPK6 n/a
9 TRCN0000195702 CCCAAGGCAAGCATGAATAAA pLKO.1 4066 3UTR 100% 15.000 10.500 N MAPK6 n/a
10 TRCN0000196364 GTTCTAGGTATATGGACTTAA pLKO.1 841 CDS 100% 13.200 9.240 N MAPK6 n/a
11 TRCN0000001570 TGATCTGGGTTCTAGGTATAT pLKO.1 833 CDS 100% 13.200 9.240 N MAPK6 n/a
12 TRCN0000315276 TGATCTGGGTTCTAGGTATAT pLKO_005 833 CDS 100% 13.200 9.240 N MAPK6 n/a
13 TRCN0000196731 GCATCTATAATGTCAGCTTAT pLKO.1 3747 3UTR 100% 10.800 7.560 N MAPK6 n/a
14 TRCN0000001569 GACATGACTGAGCCACACAAA pLKO.1 1599 CDS 100% 4.950 3.465 N MAPK6 n/a
15 TRCN0000315204 GACATGACTGAGCCACACAAA pLKO_005 1599 CDS 100% 4.950 3.465 N MAPK6 n/a
16 TRCN0000010642 CCAGGAATTAGTCGAGAAGCA pLKO.1 1638 CDS 100% 2.640 1.848 N MAPK6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005254538.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06775 pDONR223 100% 99.9% 99.8% None 868C>G n/a
2 ccsbBroad304_06775 pLX_304 0% 99.9% 99.8% V5 868C>G n/a
3 ccsbBroadEn_14802 pDONR223 0% 99.9% 99.8% None 868C>G n/a
4 ccsbBroad304_14802 pLX_304 0% 99.9% 99.8% V5 868C>G n/a
5 TRCN0000479714 CTTCCCTCTGGAGACCCTCGTTCT pLX_317 16.4% 99.9% 99.8% V5 868C>G n/a
6 TRCN0000489758 TCAGGGTCTGCACCATACTCATCA pLX_317 19.8% 99.9% 99.8% V5 (not translated due to prior stop codon) 868C>G n/a
Download CSV