Transcript: Human XM_005254611.3

PREDICTED: Homo sapiens sorting nexin 1 (SNX1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SNX1 (6642)
Length:
7819
CDS:
586..1785

Additional Resources:

NCBI RefSeq record:
XM_005254611.3
NBCI Gene record:
SNX1 (6642)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005254611.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245125 GCGTCGTAATCAGCATATAAT pLKO_005 3561 3UTR 100% 15.000 21.000 N SNX1 n/a
2 TRCN0000245121 TGATTTGACAGTCGGTATAAC pLKO_005 540 5UTR 100% 13.200 18.480 N SNX1 n/a
3 TRCN0000003977 CGGTATAACTGATCCTGAGAA pLKO.1 552 5UTR 100% 4.950 3.960 N SNX1 n/a
4 TRCN0000245124 AGTCTCGGGTGACTCAATATG pLKO_005 1481 CDS 100% 13.200 9.240 N SNX1 n/a
5 TRCN0000245122 TAGTGACTTTCTGGGTCTTTA pLKO_005 672 CDS 100% 13.200 9.240 N SNX1 n/a
6 TRCN0000003978 GAAGTGATACGGTTTGAGAAA pLKO.1 1540 CDS 100% 4.950 3.465 N SNX1 n/a
7 TRCN0000003979 CGAGAGGATTTCAACAGTGGT pLKO.1 1512 CDS 100% 2.640 1.848 N SNX1 n/a
8 TRCN0000245123 GTACCTTCAGAGGATTGTAAA pLKO_005 843 CDS 100% 0.000 0.000 N SNX1 n/a
9 TRCN0000138395 CCTTCCAAGTAGCTGGGATTA pLKO.1 4291 3UTR 100% 10.800 5.400 Y C11orf88 n/a
10 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4430 3UTR 100% 5.625 2.813 Y KLHL30 n/a
11 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4430 3UTR 100% 5.625 2.813 Y EID2B n/a
12 TRCN0000149348 GCTAAGATTCTCTGCTCCAAT pLKO.1 6813 3UTR 100% 4.950 2.475 Y SEC31A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005254611.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06984 pDONR223 100% 64.3% 63.1% None (many diffs) n/a
2 ccsbBroad304_06984 pLX_304 0% 64.3% 63.1% V5 (many diffs) n/a
3 TRCN0000467486 CATACATTCAGTAGCATGTTATTG pLX_317 23.5% 64.3% 63.1% V5 (many diffs) n/a
Download CSV