Transcript: Human XM_005254899.2

PREDICTED: Homo sapiens interferon stimulated exonuclease gene 20 (ISG20), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ISG20 (3669)
Length:
2286
CDS:
1622..2167

Additional Resources:

NCBI RefSeq record:
XM_005254899.2
NBCI Gene record:
ISG20 (3669)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005254899.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418323 TCATGACCTGAAGCACGACTT pLKO_005 1885 CDS 100% 4.050 5.670 N ISG20 n/a
2 TRCN0000430756 CCGATTACAGAACCCGGGTCA pLKO_005 1770 CDS 100% 0.720 1.008 N ISG20 n/a
3 TRCN0000425903 GACATGAGCGGCTACACAATC pLKO_005 1922 CDS 100% 10.800 8.640 N ISG20 n/a
4 TRCN0000049940 TGAGGGAGAGATCACCGATTA pLKO.1 1756 CDS 100% 10.800 7.560 N ISG20 n/a
5 TRCN0000049938 GCAACGATGGAGCTCTATCAA pLKO.1 2090 CDS 100% 5.625 3.938 N ISG20 n/a
6 TRCN0000423399 AGGCACTGAAAGAGGACATGA pLKO_005 1908 CDS 100% 4.950 3.465 N ISG20 n/a
7 TRCN0000049942 CTATCAAATCTCCCAGAGAAT pLKO.1 2104 CDS 100% 4.950 3.465 N ISG20 n/a
8 TRCN0000415098 GCTGTGCTGTACGACAAGTTC pLKO_005 1727 CDS 100% 4.950 3.465 N ISG20 n/a
9 TRCN0000423138 ATCTACGACACGTCCACTGAC pLKO_005 1940 CDS 100% 4.050 2.835 N ISG20 n/a
10 TRCN0000418704 CAAGCTGGTGGTGGGTCATGA pLKO_005 1870 CDS 100% 1.650 1.155 N ISG20 n/a
11 TRCN0000049941 GCACGACTTCCAGGCACTGAA pLKO.1 1897 CDS 100% 1.650 1.155 N ISG20 n/a
12 TRCN0000423648 TTGGACACAGCTCGGTGGAAG pLKO_005 2061 CDS 100% 1.350 0.945 N ISG20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005254899.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00883 pDONR223 100% 99.8% 100% None 414A>G n/a
2 ccsbBroad304_00883 pLX_304 0% 99.8% 100% V5 414A>G n/a
3 TRCN0000474035 AGGCTTCCTAATGATCTTCTGGTA pLX_317 82.7% 99.8% 100% V5 414A>G n/a
4 ccsbBroadEn_10924 pDONR223 100% 44.9% 42.5% None (many diffs) n/a
5 ccsbBroad304_10924 pLX_304 0% 44.9% 42.5% V5 (many diffs) n/a
6 TRCN0000471409 ATGATTAATCTAATGAATATATAT pLX_317 76.8% 44.9% 42.5% V5 (many diffs) n/a
7 TRCN0000491261 CGGAAAGATACCACACAATGCCTA pLX_317 70.6% 44.9% 42.5% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV