Transcript: Human XM_005255760.4

PREDICTED: Homo sapiens cadherin 8 (CDH8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CDH8 (1006)
Length:
10146
CDS:
567..2702

Additional Resources:

NCBI RefSeq record:
XM_005255760.4
NBCI Gene record:
CDH8 (1006)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005255760.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413231 ATGGTCAACAATCCGAATTTC pLKO_005 2181 CDS 100% 13.200 18.480 N CDH8 n/a
2 TRCN0000054225 GCTGCTCTAAACTCCGTGATT pLKO.1 1776 CDS 100% 4.950 6.930 N CDH8 n/a
3 TRCN0000433509 TATCACTTCCAGTCCTATAAG pLKO_005 1823 CDS 100% 13.200 10.560 N CDH8 n/a
4 TRCN0000054224 CCGATGAATCAGTCTCAAGTT pLKO.1 657 CDS 100% 4.950 3.960 N CDH8 n/a
5 TRCN0000054223 GCCAAGTCATTCAAACTGTTA pLKO.1 2098 CDS 100% 4.950 3.960 N CDH8 n/a
6 TRCN0000054227 GCTGGGACCATATTTCAAATA pLKO.1 879 CDS 100% 13.200 9.240 N CDH8 n/a
7 TRCN0000094388 GCATCCGAATATGAGGCATTT pLKO.1 2055 CDS 100% 10.800 7.560 N Cdh8 n/a
8 TRCN0000054226 CGCCAGAAGCAAGAAGTCTAT pLKO.1 2262 CDS 100% 4.950 3.465 N CDH8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005255760.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05974 pDONR223 100% 88.1% 87.7% None (many diffs) n/a
2 ccsbBroad304_05974 pLX_304 0% 88.1% 87.7% V5 (many diffs) n/a
3 TRCN0000479005 CGACCGTGTACTGCATGTCGAGAT pLX_317 17.4% 88.1% 87.7% V5 (many diffs) n/a
Download CSV