Transcript: Human XM_005255957.4

PREDICTED: Homo sapiens zinc finger homeobox 3 (ZFHX3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFHX3 (463)
Length:
16012
CDS:
625..11733

Additional Resources:

NCBI RefSeq record:
XM_005255957.4
NBCI Gene record:
ZFHX3 (463)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005255957.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244313 CAAGAGTTGGACCGGATTAAA pLKO_005 9856 CDS 100% 15.000 21.000 N ZFHX3 n/a
2 TRCN0000235661 GAGTTGGTCATCCAGTATAAT pLKO_005 6484 CDS 100% 15.000 21.000 N ZFHX3 n/a
3 TRCN0000235662 TCCGAGTCTTGCGGCAATATT pLKO_005 7091 CDS 100% 15.000 21.000 N ZFHX3 n/a
4 TRCN0000321358 ACCTATCTATGCCGGTGATTT pLKO_005 11894 3UTR 100% 13.200 18.480 N Zfhx3 n/a
5 TRCN0000013561 GCGATGCTCTTAGACTGTGAT pLKO.1 8866 CDS 100% 4.950 6.930 N ZFHX3 n/a
6 TRCN0000235659 GGCTATGACCAGTACTATTTA pLKO_005 14990 3UTR 100% 15.000 12.000 N ZFHX3 n/a
7 TRCN0000235660 CGAACAGGAGGAATCGTTTAA pLKO_005 2315 CDS 100% 13.200 9.240 N ZFHX3 n/a
8 TRCN0000075410 CGCTGACGAAAGTGCCAATAA pLKO.1 2394 CDS 100% 13.200 9.240 N Zfhx3 n/a
9 TRCN0000013560 CCCTTTAGTTTCCACAGCTAA pLKO.1 1671 CDS 100% 4.950 3.465 N ZFHX3 n/a
10 TRCN0000013562 CCTTGCACAAACACAGAACAA pLKO.1 11273 CDS 100% 4.950 3.465 N ZFHX3 n/a
11 TRCN0000013558 GCCAGGAAGAATTATGAGAAT pLKO.1 7510 CDS 100% 4.950 3.465 N ZFHX3 n/a
12 TRCN0000013559 CCTTACTTTGTACCAGGCTTT pLKO.1 10546 CDS 100% 4.050 2.835 N ZFHX3 n/a
13 TRCN0000413041 AGGAAGAAGAGGAGGAGGAAG pLKO_005 2051 CDS 100% 4.050 2.025 Y Myt1 n/a
14 TRCN0000138934 GAAGAGGAGGAGGAAGAAGAA pLKO.1 2056 CDS 100% 4.950 2.475 Y PTMA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005255957.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10687 pDONR223 100% 23.8% 23.8% None (many diffs) n/a
2 ccsbBroad304_10687 pLX_304 0% 23.8% 23.8% V5 (many diffs) n/a
3 TRCN0000468237 TGCGAAGATACCACGCCATCGAGC pLX_317 5.8% 23.8% 23.8% V5 (many diffs) n/a
Download CSV