Transcript: Human XM_005256945.1

PREDICTED: Homo sapiens BAR/IMD domain containing adaptor protein 2 (BAIAP2), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
BAIAP2 (10458)
Length:
2244
CDS:
109..1770

Additional Resources:

NCBI RefSeq record:
XM_005256945.1
NBCI Gene record:
BAIAP2 (10458)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005256945.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296905 CAAGTCCAACCTGGTCATTTC pLKO_005 990 CDS 100% 10.800 7.560 N BAIAP2 n/a
2 TRCN0000296966 CGCCTGACTAGAGTTAGAATC pLKO_005 1773 3UTR 100% 10.800 7.560 N BAIAP2 n/a
3 TRCN0000060951 CAGCAAGAATCCTCAGAAGTA pLKO.1 657 CDS 100% 4.950 3.465 N BAIAP2 n/a
4 TRCN0000291325 CAGCAAGAATCCTCAGAAGTA pLKO_005 657 CDS 100% 4.950 3.465 N BAIAP2 n/a
5 TRCN0000060949 GTTCTCTTCCAGATGGCTGAA pLKO.1 430 CDS 100% 4.050 2.835 N BAIAP2 n/a
6 TRCN0000060948 GCGCTGAAGAAATACCAGACT pLKO.1 562 CDS 100% 2.640 1.848 N BAIAP2 n/a
7 TRCN0000307663 GCGCTGAAGAAATACCAGACT pLKO_005 562 CDS 100% 2.640 1.848 N BAIAP2 n/a
8 TRCN0000060952 CGGTCCATGAGCAGCGCCGAT pLKO.1 1729 CDS 100% 0.000 0.000 N BAIAP2 n/a
9 TRCN0000060950 AGAGAGTGAGAAGACCAAGAT pLKO.1 1455 CDS 100% 4.950 2.970 N BAIAP2 n/a
10 TRCN0000291326 AGAGAGTGAGAAGACCAAGAT pLKO_005 1455 CDS 100% 4.950 2.970 N BAIAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005256945.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11502 pDONR223 100% 92.5% 92.4% None 54_152del;1635_1659delinsG n/a
2 ccsbBroad304_11502 pLX_304 0% 92.5% 92.4% V5 54_152del;1635_1659delinsG n/a
3 ccsbBroadEn_11501 pDONR223 100% 92.3% 92.2% None (many diffs) n/a
4 ccsbBroad304_11501 pLX_304 0% 92.3% 92.2% V5 (many diffs) n/a
5 TRCN0000465559 AACGTCTACCTACTGGCACAAAAC pLX_317 21.4% 92.3% 92.2% V5 (many diffs) n/a
Download CSV