Transcript: Human XM_005257624.3

PREDICTED: Homo sapiens signal transducer and activator of transcription 5A (STAT5A), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
STAT5A (6776)
Length:
3759
CDS:
261..2546

Additional Resources:

NCBI RefSeq record:
XM_005257624.3
NBCI Gene record:
STAT5A (6776)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005257624.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232133 TCCGGCACATTCTGTACAATG pLKO_005 586 CDS 100% 10.800 15.120 N STAT5A n/a
2 TRCN0000222115 GACCATGTACTCGATCAGGAT pLKO.1 2327 CDS 100% 2.640 3.696 N STAT5A n/a
3 TRCN0000232136 CCCACGTTTCCCGGGATATAT pLKO_005 3219 3UTR 100% 15.000 10.500 N STAT5A n/a
4 TRCN0000222112 GCGCTTTAGTGACTCAGAAAT pLKO.1 2111 CDS 100% 13.200 9.240 N STAT5A n/a
5 TRCN0000232135 ACCATTCACCACGCGGGATTT pLKO_005 2192 CDS 100% 10.800 7.560 N STAT5A n/a
6 TRCN0000232134 GGACCTTCTTGTTGCGCTTTA pLKO_005 2098 CDS 100% 10.800 7.560 N STAT5A n/a
7 TRCN0000222113 CCTGTGGAACCTGAAACCATT pLKO.1 2177 CDS 100% 4.950 3.465 N STAT5A n/a
8 TRCN0000222114 GAGAAGTTCACAGTCCTGTTT pLKO.1 1572 CDS 100% 4.950 3.465 N STAT5A n/a
9 TRCN0000222111 GCTCTGAATTAGTCCTTGCTT pLKO.1 3155 3UTR 100% 3.000 2.100 N STAT5A n/a
10 TRCN0000012553 CGCTTCTCTTTGGAAACAATA pLKO.1 2500 CDS 100% 13.200 7.920 N Stat5b n/a
11 TRCN0000232132 ATGCCATTGACTTGGACAATC pLKO_005 391 CDS 100% 10.800 6.480 N STAT5A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005257624.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07008 pDONR223 100% 90.9% 86.2% None 1902C>T;2062_2063ins160;2223_2283del n/a
2 ccsbBroad304_07008 pLX_304 0% 90.9% 86.2% V5 1902C>T;2062_2063ins160;2223_2283del n/a
3 TRCN0000473086 GCAGCTAGCTCAGGACTTTAACCG pLX_317 15% 90.9% 86.2% V5 1902C>T;2062_2063ins160;2223_2283del n/a
4 ccsbBroadEn_11162 pDONR223 100% 47.7% 48.6% None (many diffs) n/a
5 ccsbBroad304_11162 pLX_304 0% 47.7% 48.6% V5 (many diffs) n/a
6 TRCN0000473930 GGACCACCCACTCAATCTATTGCG pLX_317 45.4% 47.7% 48.6% V5 (many diffs) n/a
Download CSV