Transcript: Human XM_005259598.2

PREDICTED: Homo sapiens polypyrimidine tract binding protein 1 (PTBP1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTBP1 (5725)
Length:
3695
CDS:
604..2205

Additional Resources:

NCBI RefSeq record:
XM_005259598.2
NBCI Gene record:
PTBP1 (5725)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005259598.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000231421 ACGCGGAGAGAACCGATTAAA pLKO_005 3564 3UTR 100% 15.000 21.000 N PTBP1 n/a
2 TRCN0000231420 GCGTGAAGATCCTGTTCAATA pLKO_005 1706 CDS 100% 13.200 18.480 N PTBP1 n/a
3 TRCN0000231417 TGTCACTAACGGACCGTTTAT pLKO_005 678 CDS 100% 13.200 18.480 N PTBP1 n/a
4 TRCN0000001062 CTCAACGTCAAGTACAACAAT pLKO.1 1396 CDS 100% 5.625 7.875 N PTBP1 n/a
5 TRCN0000010584 CGTCGTCAAAGGATTCAAGTT pLKO.1 2046 CDS 100% 4.950 6.930 N PTBP1 n/a
6 TRCN0000231418 GCTTCTGCAGCAAACGGAAAT pLKO_005 715 CDS 100% 10.800 7.560 N PTBP1 n/a
7 TRCN0000001063 AGCAAACGGAAATGACAGCAA pLKO.1 723 CDS 100% 2.640 1.848 N PTBP1 n/a
8 TRCN0000010585 CCAGCCCATCTACATCCAGTT pLKO.1 978 CDS 100% 4.050 2.430 N PTBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005259598.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01329 pDONR223 100% 99.4% 99% None 3_8delGCGTGC;11G>A;13A>G n/a
2 ccsbBroad304_01329 pLX_304 0% 99.4% 99% V5 3_8delGCGTGC;11G>A;13A>G n/a
3 TRCN0000468210 AAAACCTTCTTTATGTACGACGAG pLX_317 29.2% 99.4% 99% V5 3_8delGCGTGC;11G>A;13A>G n/a
4 ccsbBroadEn_06809 pDONR223 100% 94.8% 94.2% None (many diffs) n/a
5 ccsbBroad304_06809 pLX_304 0% 94.8% 94.2% V5 (many diffs) n/a
6 TRCN0000468937 CCCGGCTTTATTTAGTGACAACTA pLX_317 23.7% 94.8% 94.2% V5 (many diffs) n/a
Download CSV