Transcript: Human XM_005262384.4

PREDICTED: Homo sapiens family with sequence similarity 122C (FAM122C), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM122C (159091)
Length:
1668
CDS:
77..643

Additional Resources:

NCBI RefSeq record:
XM_005262384.4
NBCI Gene record:
FAM122C (159091)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262384.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000263941 AGGAAGAAGCCATGGATTTAA pLKO_005 429 CDS 100% 15.000 21.000 N FAM122C n/a
2 TRCN0000263942 TGTTGCAAGCTGACATGTTAA pLKO_005 309 CDS 100% 13.200 18.480 N FAM122C n/a
3 TRCN0000263939 CTCTCTAAAGTGCATTGATTT pLKO_005 556 CDS 100% 13.200 10.560 N FAM122C n/a
4 TRCN0000282867 CATCAGCCGCCTTCATCAAAT pLKO_005 403 CDS 100% 13.200 9.240 N FAM122C n/a
5 TRCN0000263940 TGCTGGATCTTCTGGTAATTC pLKO_005 659 3UTR 100% 13.200 9.240 N FAM122C n/a
6 TRCN0000167650 GAATTAGGACAAACAGAACAA pLKO.1 330 CDS 100% 4.950 3.465 N FAM122C n/a
7 TRCN0000167421 GCAATGAGAATTGTACTGTAT pLKO.1 836 3UTR 100% 4.950 3.465 N FAM122C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262384.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05102 pDONR223 100% 80.8% 80.8% None 1_108del n/a
2 TRCN0000478791 GTTGATACAACTCGAAATACACCT pLX_317 83.4% 80.8% 80.8% V5 1_108del n/a
3 ccsbBroadEn_05101 pDONR223 100% 59.3% 53.2% None (many diffs) n/a
4 ccsbBroad304_05101 pLX_304 0% 59.3% 53.2% V5 (many diffs) n/a
5 TRCN0000471934 AGGTCATATACCATCAGAGCGAAC pLX_317 64.9% 59.3% 53.2% V5 (many diffs) n/a
6 ccsbBroadEn_16111 pDONR223 0% 42.6% 32.3% None (many diffs) n/a
7 ccsbBroad304_16111 pLX_304 0% 42.6% 32.3% V5 (many diffs) n/a
8 TRCN0000467347 CTTACCCTTGAAAATGTTCACGCA pLX_317 23.7% 42.6% 32.3% V5 (many diffs) n/a
Download CSV