Transcript: Human XM_005262955.3

PREDICTED: Homo sapiens guanylate cyclase 1 soluble subunit alpha 1 (GUCY1A1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GUCY1A1 (2982)
Length:
4580
CDS:
390..2462

Additional Resources:

NCBI RefSeq record:
XM_005262955.3
NBCI Gene record:
GUCY1A1 (2982)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005262955.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063165 CGGAAGTGGAAGTGTCGTTAA pLKO.1 1075 CDS 100% 10.800 15.120 N GUCY1A1 n/a
2 TRCN0000063163 GCCGAGTCTATCTTCACACTT pLKO.1 589 CDS 100% 4.950 6.930 N GUCY1A1 n/a
3 TRCN0000063167 GAACCTATCAAGATGCGAATT pLKO.1 2094 CDS 100% 0.000 0.000 N GUCY1A1 n/a
4 TRCN0000063164 CCTCCATTCTATGCCTGGATA pLKO.1 952 CDS 100% 4.950 3.465 N GUCY1A1 n/a
5 TRCN0000063166 CCTGAGAAGAACATACAAGAA pLKO.1 540 CDS 100% 4.950 3.465 N GUCY1A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005262955.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06342 pDONR223 100% 99.7% 99.4% None (many diffs) n/a
2 ccsbBroad304_06342 pLX_304 0% 99.7% 99.4% V5 (many diffs) n/a
3 TRCN0000475902 ACATGTTTTTGACAAGCCGTGGTG pLX_317 15.3% 99.7% 99.4% V5 (many diffs) n/a
4 ccsbBroadEn_10868 pDONR223 100% 20.1% 18% None (many diffs) n/a
5 ccsbBroad304_10868 pLX_304 0% 20.1% 18% V5 (many diffs) n/a
6 TRCN0000475104 CTTGATCCTTGTCTTACCGCAACG pLX_317 100% 20.1% 18% V5 (many diffs) n/a
Download CSV