Transcript: Human XM_005268293.2

PREDICTED: Homo sapiens tubulin gamma complex associated protein 3 (TUBGCP3), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TUBGCP3 (10426)
Length:
2771
CDS:
190..2646

Additional Resources:

NCBI RefSeq record:
XM_005268293.2
NBCI Gene record:
TUBGCP3 (10426)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005268293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108336 CGGGTGGTACTATGGAAATTA pLKO.1 905 CDS 100% 15.000 21.000 N TUBGCP3 n/a
2 TRCN0000108338 GCCACTACCTAAGAGTATTTA pLKO.1 2162 CDS 100% 15.000 21.000 N TUBGCP3 n/a
3 TRCN0000431039 TTCCTGTACCGCTGGATATAT pLKO_005 1474 CDS 100% 15.000 21.000 N TUBGCP3 n/a
4 TRCN0000091980 GAGGACACTTACCACGAATTT pLKO.1 1507 CDS 100% 13.200 9.240 N Tubgcp3 n/a
5 TRCN0000108339 GCATGGACTTTAACTGCAAAT pLKO.1 799 CDS 100% 10.800 7.560 N TUBGCP3 n/a
6 TRCN0000108337 CCTGAGAAACATGCCAGAGTT pLKO.1 2259 CDS 100% 4.950 3.465 N TUBGCP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005268293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11497 pDONR223 100% 99.1% 99% None (many diffs) n/a
2 ccsbBroad304_11497 pLX_304 0% 99.1% 99% V5 (many diffs) n/a
3 TRCN0000479745 TACCAATGGACGCTCGAGTAGTCT pLX_317 14.4% 99.1% 99% V5 (many diffs) n/a
4 ccsbBroadEn_11496 pDONR223 100% 51.4% 49.1% None (many diffs) n/a
5 ccsbBroad304_11496 pLX_304 0% 51.4% 49.1% V5 (many diffs) n/a
6 TRCN0000480095 ACAACAACATTCGCGCAAGGGGGT pLX_317 30.4% 51.4% 49.1% V5 (many diffs) n/a
Download CSV