Transcript: Human XM_005268909.4

PREDICTED: Homo sapiens nuclear transcription factor Y subunit beta (NFYB), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NFYB (4801)
Length:
2826
CDS:
246..872

Additional Resources:

NCBI RefSeq record:
XM_005268909.4
NBCI Gene record:
NFYB (4801)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005268909.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285134 GGAATCTCTGCAGACTATATT pLKO_005 294 CDS 100% 15.000 12.000 N NFYB n/a
2 TRCN0000014956 GCAAGTGAAAGGTGCCATCAA pLKO.1 549 CDS 100% 4.950 3.960 N NFYB n/a
3 TRCN0000285137 AGTTACCAGCTGGCTTAATAA pLKO_005 766 CDS 100% 15.000 10.500 N NFYB n/a
4 TRCN0000349712 AGTTACCAGCTGGCTTAATAA pLKO_005 766 CDS 100% 15.000 10.500 N Nfyb n/a
5 TRCN0000285140 AGCAAACGTGGCTAGGATAAT pLKO_005 431 CDS 100% 13.200 9.240 N NFYB n/a
6 TRCN0000274068 TTGACTAATTGAGGTGTTAAT pLKO_005 1007 3UTR 100% 13.200 9.240 N NFYB n/a
7 TRCN0000312855 TTGACTAATTGAGGTGTTAAT pLKO_005 1007 3UTR 100% 13.200 9.240 N Nfyb n/a
8 TRCN0000014954 CCAAAGAATGTGTTCAAGAAT pLKO.1 493 CDS 100% 5.625 3.938 N NFYB n/a
9 TRCN0000274128 CCAAAGAATGTGTTCAAGAAT pLKO_005 493 CDS 100% 5.625 3.938 N NFYB n/a
10 TRCN0000014957 CACAACATCATATCAACAGAT pLKO.1 821 CDS 100% 4.950 3.465 N NFYB n/a
11 TRCN0000084488 CGAGAGTTTGTTGCTCTGTAT pLKO.1 1108 3UTR 100% 4.950 3.465 N Nfyb n/a
12 TRCN0000014953 GCTCATATTGTGCATACCATT pLKO.1 2446 3UTR 100% 4.950 3.465 N NFYB n/a
13 TRCN0000014955 GCTATGTCTACTTTAGGCTTT pLKO.1 609 CDS 100% 4.050 2.835 N NFYB n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005268909.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06639 pDONR223 100% 99% 98% None 4_5insC;6_9delCCTG;15T>G n/a
2 ccsbBroad304_06639 pLX_304 0% 99% 98% V5 4_5insC;6_9delCCTG;15T>G n/a
3 TRCN0000466384 ATCACAGACGATGAGCTCGGCGGG pLX_317 73.3% 99% 98% V5 4_5insC;6_9delCCTG;15T>G n/a
4 ccsbBroadEn_15506 pDONR223 0% 99% 98% None 4_5insC;6_9delCCTG;90A>G n/a
5 ccsbBroad304_15506 pLX_304 0% 99% 98% V5 4_5insC;6_9delCCTG;90A>G n/a
Download CSV