Transcript: Human XM_005269741.4

PREDICTED: Homo sapiens annexin A11 (ANXA11), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANXA11 (311)
Length:
3733
CDS:
16..1833

Additional Resources:

NCBI RefSeq record:
XM_005269741.4
NBCI Gene record:
ANXA11 (311)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005269741.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380098 GGCTTCATTTCGTCATGTAAT pLKO_005 2128 3UTR 100% 13.200 18.480 N ANXA11 n/a
2 TRCN0000056374 CCAGTCCTCTTTGACATTTAT pLKO.1 1132 CDS 100% 15.000 10.500 N ANXA11 n/a
3 TRCN0000315756 CCAGTCCTCTTTGACATTTAT pLKO_005 1132 CDS 100% 15.000 10.500 N ANXA11 n/a
4 TRCN0000056375 CGTGGTGAAATGTCTCAAGAA pLKO.1 1587 CDS 100% 4.950 3.465 N ANXA11 n/a
5 TRCN0000315758 CGTGGTGAAATGTCTCAAGAA pLKO_005 1587 CDS 100% 4.950 3.465 N ANXA11 n/a
6 TRCN0000056377 GCAGATCCTACTTTCCTTCAA pLKO.1 1023 CDS 100% 4.950 3.465 N ANXA11 n/a
7 TRCN0000315685 GCAGATCCTACTTTCCTTCAA pLKO_005 1023 CDS 100% 4.950 3.465 N ANXA11 n/a
8 TRCN0000056376 CCCTCCAGGATGCCCTCATAT pLKO.1 655 CDS 100% 4.400 3.080 N ANXA11 n/a
9 TRCN0000056373 CCGAGAATTAAACAGAGCCTA pLKO.1 1236 CDS 100% 2.640 1.848 N ANXA11 n/a
10 TRCN0000315757 CCGAGAATTAAACAGAGCCTA pLKO_005 1236 CDS 100% 2.640 1.848 N ANXA11 n/a
11 TRCN0000180418 GATCACTTGAGCTCAGGAGTT pLKO.1 3215 3UTR 100% 4.050 2.025 Y ERN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005269741.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00073 pDONR223 100% 82% 81.3% None (many diffs) n/a
2 ccsbBroad304_00073 pLX_304 0% 82% 81.3% V5 (many diffs) n/a
3 TRCN0000470292 ACGCGCCCGATCCCCACTTCCAAT pLX_317 31.5% 82% 81.3% V5 (many diffs) n/a
Download CSV