Transcript: Human XM_005270767.3

PREDICTED: Homo sapiens cytochrome P450 family 4 subfamily A member 22 (CYP4A22), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYP4A22 (284541)
Length:
2250
CDS:
44..1309

Additional Resources:

NCBI RefSeq record:
XM_005270767.3
NBCI Gene record:
CYP4A22 (284541)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005270767.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244739 CTTGCTCTCCCAGGATCAATT pLKO_005 1769 3UTR 100% 13.200 6.600 Y CYP4A11 n/a
2 TRCN0000147049 CCACCTGTTTCTTTGTTTGAT pLKO.1 1912 3UTR 100% 5.625 2.813 Y CYP4A11 n/a
3 TRCN0000029419 CCTGACTATATGAAGGTGATT pLKO.1 347 CDS 100% 4.950 2.475 Y CYP4A22 n/a
4 TRCN0000029422 CGACTTGTGTTGAAATCCAAA pLKO.1 1226 CDS 100% 4.950 2.475 Y CYP4A22 n/a
5 TRCN0000029420 CGGGAAACAATTTGCCATGAA pLKO.1 1123 CDS 100% 4.950 2.475 Y CYP4A22 n/a
6 TRCN0000179008 CGGGAAACAATTTGCCATGAA pLKO.1 1123 CDS 100% 4.950 2.475 Y CYP4A11 n/a
7 TRCN0000029423 GCTGGAGAAGATCAAGAGGAA pLKO.1 725 CDS 100% 2.640 1.320 Y CYP4A22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005270767.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13531 pDONR223 100% 67.8% 60% None (many diffs) n/a
2 ccsbBroad304_13531 pLX_304 0% 67.8% 60% V5 (many diffs) n/a
3 TRCN0000475714 GATATTATAATTATCCGTCACCAT pLX_317 22.5% 67.8% 60% V5 (many diffs) n/a
4 ccsbBroadEn_13841 pDONR223 100% 47.5% 44.9% None (many diffs) n/a
5 ccsbBroad304_13841 pLX_304 0% 47.5% 44.9% V5 (many diffs) n/a
6 TRCN0000475433 ACCCCTCCCGAATACTTATGAATA pLX_317 55.9% 47.5% 44.9% V5 (many diffs) n/a
Download CSV