Transcript: Human XM_005271112.5

PREDICTED: Homo sapiens splicing factor proline and glutamine rich (SFPQ), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SFPQ (6421)
Length:
5793
CDS:
125..2248

Additional Resources:

NCBI RefSeq record:
XM_005271112.5
NBCI Gene record:
SFPQ (6421)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005271112.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001083 CCCTTTCTGTTCGTAATCTTT pLKO.1 1239 CDS 100% 5.625 3.938 N SFPQ n/a
2 TRCN0000318587 CCCTTTCTGTTCGTAATCTTT pLKO_005 1239 CDS 100% 5.625 3.938 N SFPQ n/a
3 TRCN0000010589 CGGTTGTTTGTTGGGAATCTA pLKO.1 1016 CDS 100% 5.625 3.938 N SFPQ n/a
4 TRCN0000349565 CGGTTGTTTGTTGGGAATCTA pLKO_005 1016 CDS 100% 5.625 3.938 N SFPQ n/a
5 TRCN0000001084 GCGCCAAAGAGAGGAAAGTTA pLKO.1 1894 CDS 100% 5.625 3.938 N SFPQ n/a
6 TRCN0000349630 GCGCCAAAGAGAGGAAAGTTA pLKO_005 1894 CDS 100% 5.625 3.938 N SFPQ n/a
7 TRCN0000102241 CCAGTCATTGTGGAACCACTT pLKO.1 1454 CDS 100% 4.050 2.835 N Sfpq n/a
8 TRCN0000001081 GACCAACAAATCTCAAGCCCT pLKO.1 3031 3UTR 100% 0.660 0.462 N SFPQ n/a
9 TRCN0000001082 GCCCAGAAGAATCCAATGTAT pLKO.1 1514 CDS 100% 5.625 3.375 N SFPQ n/a
10 TRCN0000349629 GCCCAGAAGAATCCAATGTAT pLKO_005 1514 CDS 100% 5.625 3.375 N SFPQ n/a
11 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3207 3UTR 100% 4.950 2.475 Y ERAP2 n/a
12 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3208 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005271112.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06934 pDONR223 100% 99.8% 99.4% None (many diffs) n/a
2 ccsbBroad304_06934 pLX_304 0% 99.8% 99.4% V5 (many diffs) n/a
3 TRCN0000476555 ATCAGGAGGGATTTCTCCAGACCT pLX_317 17.1% 99.8% 99.4% V5 (many diffs) n/a
Download CSV